\
| Variant ID: vg0410390615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10390615 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 89. )
TAACATATACTTTGTTCTAAGTGATTTATACTATCTCGGCATGGCGACCGATCTATCCCGATCACTTGATTTAAGTATATATCGACATAAGGATTATATA[T/C]
TGTTAATATCTACAGCCGATCGAGTAGATTTAGTTCTTTCTTATATATTCATGATTGCCGATCGATCCACATATGACATCGGCTCCGAGATAAATGATAC
GTATCATTTATCTCGGAGCCGATGTCATATGTGGATCGATCGGCAATCATGAATATATAAGAAAGAACTAAATCTACTCGATCGGCTGTAGATATTAACA[A/G]
TATATAATCCTTATGTCGATATATACTTAAATCAAGTGATCGGGATAGATCGGTCGCCATGCCGAGATAGTATAAATCACTTAGAACAAAGTATATGTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.70% | 18.40% | 5.23% | 9.69% | NA |
| All Indica | 2759 | 48.90% | 27.70% | 8.45% | 14.97% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 50.60% | 30.90% | 3.72% | 14.87% | NA |
| Indica I | 595 | 22.90% | 42.40% | 18.32% | 16.47% | NA |
| Indica II | 465 | 72.50% | 15.70% | 5.38% | 6.45% | NA |
| Indica III | 913 | 51.50% | 23.70% | 5.70% | 19.17% | NA |
| Indica Intermediate | 786 | 51.70% | 28.40% | 5.98% | 13.99% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 9.40% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 84.40% | 13.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410390615 | T -> C | LOC_Os04g18730.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.474; most accessible tissue: Callus, score: 20.701 | N | N | N | N |
| vg0410390615 | T -> DEL | N | N | silent_mutation | Average:7.474; most accessible tissue: Callus, score: 20.701 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410390615 | NA | 2.90E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 6.42E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 4.86E-09 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 2.97E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 6.80E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 3.86E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 1.81E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 9.10E-15 | mr1835_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 2.68E-08 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390615 | NA | 2.53E-18 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |