\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410390615:

Variant ID: vg0410390615 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10390615
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TAACATATACTTTGTTCTAAGTGATTTATACTATCTCGGCATGGCGACCGATCTATCCCGATCACTTGATTTAAGTATATATCGACATAAGGATTATATA[T/C]
TGTTAATATCTACAGCCGATCGAGTAGATTTAGTTCTTTCTTATATATTCATGATTGCCGATCGATCCACATATGACATCGGCTCCGAGATAAATGATAC

Reverse complement sequence

GTATCATTTATCTCGGAGCCGATGTCATATGTGGATCGATCGGCAATCATGAATATATAAGAAAGAACTAAATCTACTCGATCGGCTGTAGATATTAACA[A/G]
TATATAATCCTTATGTCGATATATACTTAAATCAAGTGATCGGGATAGATCGGTCGCCATGCCGAGATAGTATAAATCACTTAGAACAAAGTATATGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.70% 18.40% 5.23% 9.69% NA
All Indica  2759 48.90% 27.70% 8.45% 14.97% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 50.60% 30.90% 3.72% 14.87% NA
Indica I  595 22.90% 42.40% 18.32% 16.47% NA
Indica II  465 72.50% 15.70% 5.38% 6.45% NA
Indica III  913 51.50% 23.70% 5.70% 19.17% NA
Indica Intermediate  786 51.70% 28.40% 5.98% 13.99% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 9.40% 2.08% 4.17% NA
Intermediate  90 84.40% 13.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410390615 T -> C LOC_Os04g18730.1 intron_variant ; MODIFIER silent_mutation Average:7.474; most accessible tissue: Callus, score: 20.701 N N N N
vg0410390615 T -> DEL N N silent_mutation Average:7.474; most accessible tissue: Callus, score: 20.701 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410390615 NA 2.90E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 6.42E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 4.86E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 2.97E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 6.80E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 3.86E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 1.81E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 9.10E-15 mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 2.68E-08 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410390615 NA 2.53E-18 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251