\
| Variant ID: vg0410309978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10309978 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 304. )
CGAAGGGGTACGAAGGGTGCTTGAATAGATGTCAAAATGTTCGGTCCTTAACGACTCAGACCGGGCTACTTGCATCAGAGGAAAACCAACCTCCCTTCAT[T/C]
GCCCTATCACCCGTCCAAGTCCAACATATTTCATCAACCATTATTTAGCGTAAGTGCTCAAGTTTTATGCCCAATAATGCAAGTTGTCTATATACCACAA
TTGTGGTATATAGACAACTTGCATTATTGGGCATAAAACTTGAGCACTTACGCTAAATAATGGTTGATGAAATATGTTGGACTTGGACGGGTGATAGGGC[A/G]
ATGAAGGGAGGTTGGTTTTCCTCTGATGCAAGTAGCCCGGTCTGAGTCGTTAAGGACCGAACATTTTGACATCTATTCAAGCACCCTTCGTACCCCTTCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 20.40% | 0.51% | 2.60% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 33.90% | 61.00% | 1.46% | 3.64% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 3.70% | 96.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 83.30% | 4.40% | 3.77% | 8.53% | NA |
| Japonica Intermediate | 241 | 27.00% | 68.00% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 33.30% | 0.00% | 2.08% | 64.58% | NA |
| Intermediate | 90 | 74.40% | 20.00% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410309978 | T -> C | LOC_Os04g18640.1 | upstream_gene_variant ; 2450.0bp to feature; MODIFIER | silent_mutation | Average:43.75; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg0410309978 | T -> C | LOC_Os04g18640-LOC_Os04g18650 | intergenic_region ; MODIFIER | silent_mutation | Average:43.75; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg0410309978 | T -> DEL | N | N | silent_mutation | Average:43.75; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410309978 | NA | 2.58E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 2.18E-34 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 3.74E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 2.12E-11 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 5.08E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 8.71E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 2.46E-31 | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 6.15E-13 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 2.06E-40 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 8.30E-11 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 6.41E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | NA | 5.82E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410309978 | 3.71E-08 | NA | mr1758_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |