\
| Variant ID: vg0410306276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10306276 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.06, others allele: 0.00, population size: 250. )
TGCATCATCGCTTCAAAATCTTTCTTTTGATCAGGTGTGAACTTTTCTGGGTCGATGGTCACGATGTTCCCTTCATTAACGTCTGTCAAATCTAACTTCT[C/T,G]
GATCTTTTCTTTAACAGAACCTGGGCTAGAAGAGGACGGTGATGGCGGTAGTTTCTCGGCCGTGAAGAAAACTGCTCGTCTGACTTCTAATCTGTCCCAT
ATGGGACAGATTAGAAGTCAGACGAGCAGTTTTCTTCACGGCCGAGAAACTACCGCCATCACCGTCCTCTTCTAGCCCAGGTTCTGTTAAAGAAAAGATC[G/A,C]
AGAAGTTAGATTTGACAGACGTTAATGAAGGGAACATCGTGACCATCGACCCAGAAAAGTTCACACCTGATCAAAAGAAAGATTTTGAAGCGATGATGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 20.50% | 1.54% | 12.36% | NA |
| All Indica | 2759 | 98.80% | 0.90% | 0.07% | 0.22% | NA |
| All Japonica | 1512 | 2.10% | 61.00% | 0.53% | 36.38% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.30% | 0.22% | 0.65% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.10% | 1.50% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 0.40% | 96.00% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 3.40% | 4.60% | 1.39% | 90.67% | NA |
| Japonica Intermediate | 241 | 4.60% | 68.00% | 0.41% | 26.97% | NA |
| VI/Aromatic | 96 | 22.90% | 1.00% | 60.42% | 15.62% | NA |
| Intermediate | 90 | 57.80% | 22.20% | 5.56% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410306276 | C -> DEL | LOC_Os04g18640.1 | N | frameshift_variant | Average:49.018; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0410306276 | C -> G | LOC_Os04g18640.1 | missense_variant ; p.Glu80Gln; MODERATE | N | Average:49.018; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0410306276 | C -> G | LOC_Os04g18630.1 | upstream_gene_variant ; 4779.0bp to feature; MODIFIER | N | Average:49.018; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | N | N | N | N |
| vg0410306276 | C -> T | LOC_Os04g18640.1 | missense_variant ; p.Glu80Lys; MODERATE | nonsynonymous_codon ; E80K | Average:49.018; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 | benign |
0.242 |
TOLERATED | 0.95 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410306276 | NA | 1.57E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 2.31E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 5.86E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 2.77E-10 | mr1551 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 1.20E-09 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | 1.01E-06 | NA | mr1902 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 1.77E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410306276 | NA | 9.81E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |