\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410291056:

Variant ID: vg0410291056 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10291056
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCCCGCGTTATCACTGTTTTATCTAGCCATGCCTATTTACCTTTGTTATGACCTTATTATTGTTATTGTATTATTTCCTTGTTCACCCTAGAATAA[A/G]
CAAAACCCCAACTAGTGGACACTCTACTCATGGTACCACTAGTATGATTTTAGGTAGATGCTTCGCTGGTTAATTAGGCAACATTAGGTGGTTTTACAAC

Reverse complement sequence

GTTGTAAAACCACCTAATGTTGCCTAATTAACCAGCGAAGCATCTACCTAAAATCATACTAGTGGTACCATGAGTAGAGTGTCCACTAGTTGGGGTTTTG[T/C]
TTATTCTAGGGTGAACAAGGAAATAATACAATAACAATAATAAGGTCATAACAAAGGTAAATAGGCATGGCTAGATAAAACAGTGATAACGCGGGAATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.90% 0.60% 44.46% 31.08% NA
All Indica  2759 6.10% 0.70% 68.00% 25.30% NA
All Japonica  1512 62.00% 0.50% 0.66% 36.84% NA
Aus  269 1.10% 0.00% 66.54% 32.34% NA
Indica I  595 8.70% 0.70% 44.03% 46.55% NA
Indica II  465 7.70% 1.30% 62.80% 28.17% NA
Indica III  913 2.20% 0.00% 87.84% 9.97% NA
Indica Intermediate  786 7.50% 1.00% 66.16% 25.32% NA
Temperate Japonica  767 96.10% 0.00% 0.13% 3.78% NA
Tropical Japonica  504 6.70% 1.60% 0.99% 90.67% NA
Japonica Intermediate  241 68.90% 0.00% 1.66% 29.46% NA
VI/Aromatic  96 0.00% 0.00% 6.25% 93.75% NA
Intermediate  90 25.60% 0.00% 33.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410291056 A -> DEL N N silent_mutation Average:9.242; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0410291056 A -> G LOC_Os04g18610.1 upstream_gene_variant ; 363.0bp to feature; MODIFIER silent_mutation Average:9.242; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0410291056 A -> G LOC_Os04g18620.1 downstream_gene_variant ; 4978.0bp to feature; MODIFIER silent_mutation Average:9.242; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0410291056 A -> G LOC_Os04g18600-LOC_Os04g18610 intergenic_region ; MODIFIER silent_mutation Average:9.242; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410291056 NA 1.68E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410291056 9.42E-08 8.04E-10 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410291056 NA 3.75E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410291056 NA 2.00E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410291056 NA 4.09E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251