\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410263031:

Variant ID: vg0410263031 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10263031
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.05, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTCTTTGCTGACTCATTTGGCACCTCAATATTATTATCTCTGATATCCCCATGTATAGCACCACTAATTAGCGAAGAAAGAAGATTATCGACAGAGC[T/C]
GCCATCATCAACTTCAGCTTCACTAATTTCCTAATCATCCACAACCATAGGTTTACTAACAGAACGTTTCTGTTTTATGAAATCCTTATCAAACCCTCAA

Reverse complement sequence

TTGAGGGTTTGATAAGGATTTCATAAAACAGAAACGTTCTGTTAGTAAACCTATGGTTGTGGATGATTAGGAAATTAGTGAAGCTGAAGTTGATGATGGC[A/G]
GCTCTGTCGATAATCTTCTTTCTTCGCTAATTAGTGGTGCTATACATGGGGATATCAGAGATAATAATATTGAGGTGCCAAATGAGTCAGCAAAGAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 12.60% 0.97% 62.21% NA
All Indica  2759 7.30% 1.40% 1.59% 89.71% NA
All Japonica  1512 60.70% 34.90% 0.00% 4.37% NA
Aus  269 1.10% 0.70% 0.37% 97.77% NA
Indica I  595 11.80% 0.30% 2.02% 85.88% NA
Indica II  465 10.50% 1.90% 1.51% 86.02% NA
Indica III  913 2.10% 1.30% 1.10% 95.51% NA
Indica Intermediate  786 8.10% 1.90% 1.91% 88.04% NA
Temperate Japonica  767 96.00% 3.40% 0.00% 0.65% NA
Tropical Japonica  504 4.20% 86.90% 0.00% 8.93% NA
Japonica Intermediate  241 66.80% 26.60% 0.00% 6.64% NA
VI/Aromatic  96 0.00% 7.30% 0.00% 92.71% NA
Intermediate  90 24.40% 22.20% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410263031 T -> C LOC_Os04g18580.1 missense_variant ; p.Ser149Gly; MODERATE nonsynonymous_codon ; S149G Average:17.679; most accessible tissue: Callus, score: 52.96 unknown unknown TOLERATED 0.47
vg0410263031 T -> DEL LOC_Os04g18580.1 N frameshift_variant Average:17.679; most accessible tissue: Callus, score: 52.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410263031 NA 2.96E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.82E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 2.17E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.42E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 2.15E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 9.29E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 4.91E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 4.89E-06 4.89E-06 mr1338 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 5.73E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.88E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.88E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 6.44E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 1.12E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 5.68E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.67E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 6.49E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 2.09E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.57E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 3.46E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 6.15E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 2.12E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 4.84E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410263031 NA 8.34E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251