\
| Variant ID: vg0410263031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10263031 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.05, others allele: 0.00, population size: 55. )
AAATTCTTTGCTGACTCATTTGGCACCTCAATATTATTATCTCTGATATCCCCATGTATAGCACCACTAATTAGCGAAGAAAGAAGATTATCGACAGAGC[T/C]
GCCATCATCAACTTCAGCTTCACTAATTTCCTAATCATCCACAACCATAGGTTTACTAACAGAACGTTTCTGTTTTATGAAATCCTTATCAAACCCTCAA
TTGAGGGTTTGATAAGGATTTCATAAAACAGAAACGTTCTGTTAGTAAACCTATGGTTGTGGATGATTAGGAAATTAGTGAAGCTGAAGTTGATGATGGC[A/G]
GCTCTGTCGATAATCTTCTTTCTTCGCTAATTAGTGGTGCTATACATGGGGATATCAGAGATAATAATATTGAGGTGCCAAATGAGTCAGCAAAGAATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.20% | 12.60% | 0.97% | 62.21% | NA |
| All Indica | 2759 | 7.30% | 1.40% | 1.59% | 89.71% | NA |
| All Japonica | 1512 | 60.70% | 34.90% | 0.00% | 4.37% | NA |
| Aus | 269 | 1.10% | 0.70% | 0.37% | 97.77% | NA |
| Indica I | 595 | 11.80% | 0.30% | 2.02% | 85.88% | NA |
| Indica II | 465 | 10.50% | 1.90% | 1.51% | 86.02% | NA |
| Indica III | 913 | 2.10% | 1.30% | 1.10% | 95.51% | NA |
| Indica Intermediate | 786 | 8.10% | 1.90% | 1.91% | 88.04% | NA |
| Temperate Japonica | 767 | 96.00% | 3.40% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 4.20% | 86.90% | 0.00% | 8.93% | NA |
| Japonica Intermediate | 241 | 66.80% | 26.60% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 0.00% | 7.30% | 0.00% | 92.71% | NA |
| Intermediate | 90 | 24.40% | 22.20% | 1.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410263031 | T -> C | LOC_Os04g18580.1 | missense_variant ; p.Ser149Gly; MODERATE | nonsynonymous_codon ; S149G | Average:17.679; most accessible tissue: Callus, score: 52.96 | unknown | unknown | TOLERATED | 0.47 |
| vg0410263031 | T -> DEL | LOC_Os04g18580.1 | N | frameshift_variant | Average:17.679; most accessible tissue: Callus, score: 52.96 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410263031 | NA | 2.96E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.82E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 2.17E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.42E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 2.15E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 9.29E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 4.91E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | 4.89E-06 | 4.89E-06 | mr1338 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 5.73E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.88E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.88E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 6.44E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 1.12E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 5.68E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.67E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 6.49E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 2.09E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.57E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 3.46E-13 | mr1789 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 6.15E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 2.12E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 4.84E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410263031 | NA | 8.34E-07 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |