Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410250947:

Variant ID: vg0410250947 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10250947
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGACGACGACGGAAACCATACCTCACTTCCCCTCGACCACGCCGGGGTCGGCGTCCACACGCCGGTACTAGCCCAACTCACCAACACCGGGTTTCACCC[G/C]
CCGCATCTCGTCCACGCCTGGGTCGTCAGCCACCAAGGCGAAGGTGATGCCGACCGACGTCGATGTCGACGACGACGACAAGGCCGACATTGCAGATGTG

Reverse complement sequence

CACATCTGCAATGTCGGCCTTGTCGTCGTCGTCGACATCGACGTCGGTCGGCATCACCTTCGCCTTGGTGGCTGACGACCCAGGCGTGGACGAGATGCGG[C/G]
GGGTGAAACCCGGTGTTGGTGAGTTGGGCTAGTACCGGCGTGTGGACGCCGACCCCGGCGTGGTCGAGGGGAAGTGAGGTATGGTTTCCGTCGTCGTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	15.10%	1.42%	29.07%	NA
All Indica	2759	55.00%	0.90%	2.25%	41.86%	NA
All Japonica	1512	61.20%	38.20%	0.00%	0.60%	NA
Aus	269	33.10%	0.00%	1.49%	65.43%	NA
Indica I	595	83.00%	0.20%	1.01%	15.80%	NA
Indica II	465	33.10%	1.70%	5.38%	59.78%	NA
Indica III	913	48.10%	0.70%	1.53%	49.73%	NA
Indica Intermediate	786	54.70%	1.30%	2.16%	41.86%	NA
Temperate Japonica	767	96.30%	3.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.60%	94.60%	0.00%	0.79%	NA
Japonica Intermediate	241	67.60%	30.30%	0.00%	2.07%	NA
VI/Aromatic	96	1.00%	86.50%	1.04%	11.46%	NA
Intermediate	90	42.20%	32.20%	0.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410250947	G -> C	LOC_Os04g18559.1	missense_variant ; p.Arg31Gly; MODERATE	nonsynonymous_codon ; R31G	Average:17.793; most accessible tissue: Callus, score: 49.518	unknown	unknown	TOLERATED	0.07
vg0410250947	G -> DEL	LOC_Os04g18559.1	N	frameshift_variant	Average:17.793; most accessible tissue: Callus, score: 49.518	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410250947	NA	3.82E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.59E-09	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.87E-09	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.17E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.42E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	9.45E-06	6.84E-08	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	9.29E-08	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	3.34E-06	4.06E-09	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	7.98E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	4.91E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	1.48E-06	9.74E-09	mr1395	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	5.73E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.88E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	4.27E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.88E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	8.27E-07	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	3.02E-06	2.81E-08	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.92E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.67E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.57E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.46E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	6.15E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.12E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	3.23E-09	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	5.19E-09	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	4.07E-08	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.52E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	2.40E-11	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	4.83E-10	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410250947	NA	4.55E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251