\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410239270:

Variant ID: vg0410239270 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10239270
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCATTCTCGGTGTTAGTGCTTCCATCTTTATGATACTTTAATCTTGTTTATGTAATTCGTCGAAGTTATCATATATCTTATATAATCTCCGGCAATATCG[C/T]
TATCTAACCTTAAATCGGCTAACGTCTGTTATTAGAAGGTAGCCGATTAGGTTAAATACCAACATTGACTTAGATTACATAGGATATCAACCACTCTTTG

Reverse complement sequence

CAAAGAGTGGTTGATATCCTATGTAATCTAAGTCAATGTTGGTATTTAACCTAATCGGCTACCTTCTAATAACAGACGTTAGCCGATTTAAGGTTAGATA[G/A]
CGATATTGCCGGAGATTATATAAGATATATGATAACTTCGACGAATTACATAAACAAGATTAAAGTATCATAAAGATGGAAGCACTAACACCGAGAATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 1.50% 16.48% 40.88% NA
All Indica  2759 10.70% 2.40% 25.84% 61.11% NA
All Japonica  1512 99.10% 0.00% 0.13% 0.79% NA
Aus  269 4.50% 2.60% 18.96% 73.98% NA
Indica I  595 10.40% 0.50% 13.61% 75.46% NA
Indica II  465 13.30% 1.90% 18.92% 65.81% NA
Indica III  913 7.30% 3.10% 40.74% 48.85% NA
Indica Intermediate  786 13.20% 3.20% 21.88% 61.70% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 87.50% 0.00% 2.08% 10.42% NA
Intermediate  90 60.00% 0.00% 12.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410239270 C -> DEL N N silent_mutation Average:8.603; most accessible tissue: Callus, score: 28.168 N N N N
vg0410239270 C -> T LOC_Os04g18520.1 upstream_gene_variant ; 3494.0bp to feature; MODIFIER silent_mutation Average:8.603; most accessible tissue: Callus, score: 28.168 N N N N
vg0410239270 C -> T LOC_Os04g18530.1 downstream_gene_variant ; 934.0bp to feature; MODIFIER silent_mutation Average:8.603; most accessible tissue: Callus, score: 28.168 N N N N
vg0410239270 C -> T LOC_Os04g18540.1 downstream_gene_variant ; 4536.0bp to feature; MODIFIER silent_mutation Average:8.603; most accessible tissue: Callus, score: 28.168 N N N N
vg0410239270 C -> T LOC_Os04g18520-LOC_Os04g18530 intergenic_region ; MODIFIER silent_mutation Average:8.603; most accessible tissue: Callus, score: 28.168 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410239270 2.78E-06 9.31E-07 mr1426 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251