\
| Variant ID: vg0410214235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10214235 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 62. )
GCAAGGTGACAAGATTGAGATCGTGCCAGCCGACAGGTCAGTTAATGTTGCCAGTGCCGATTTAGCTCTTTGGGAGATGGACGGTATTGATTGCTTGTCT[A/G]
GAAAGTGTCCGATTGTGATATACAACCGATTGAAGATGGAGAGCCCAAGTTATTATTTTGAGGGCGTCGTGGAGGGTTCAAACGTCTACACCAAGGACAC
GTGTCCTTGGTGTAGACGTTTGAACCCTCCACGACGCCCTCAAAATAATAACTTGGGCTCTCCATCTTCAATCGGTTGTATATCACAATCGGACACTTTC[T/C]
AGACAAGCAATCAATACCGTCCATCTCCCAAAGAGCTAAATCGGCACTGGCAACATTAACTGACCTGTCGGCTGGCACGATCTCAATCTTGTCACCTTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 15.70% | 5.67% | 42.23% | NA |
| All Indica | 2759 | 25.80% | 1.70% | 8.19% | 64.30% | NA |
| All Japonica | 1512 | 60.80% | 38.30% | 0.60% | 0.26% | NA |
| Aus | 269 | 19.70% | 0.70% | 5.95% | 73.61% | NA |
| Indica I | 595 | 53.90% | 1.20% | 6.55% | 38.32% | NA |
| Indica II | 465 | 29.20% | 2.20% | 9.89% | 58.71% | NA |
| Indica III | 913 | 2.60% | 1.20% | 8.65% | 87.51% | NA |
| Indica Intermediate | 786 | 29.40% | 2.40% | 7.89% | 60.31% | NA |
| Temperate Japonica | 767 | 95.80% | 3.70% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 4.60% | 94.80% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 67.20% | 30.30% | 2.07% | 0.41% | NA |
| VI/Aromatic | 96 | 7.30% | 85.40% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 33.30% | 11.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410214235 | A -> DEL | LOC_Os04g18480.1 | N | frameshift_variant | Average:11.714; most accessible tissue: Callus, score: 19.156 | N | N | N | N |
| vg0410214235 | A -> G | LOC_Os04g18480.1 | missense_variant ; p.Arg503Gly; MODERATE | nonsynonymous_codon ; R503G | Average:11.714; most accessible tissue: Callus, score: 19.156 | unknown | unknown | TOLERATED | 0.40 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410214235 | NA | 3.24E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 2.42E-06 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 9.30E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 1.27E-06 | mr1388 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 1.12E-06 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 1.69E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 2.73E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 5.29E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | 2.21E-06 | 2.21E-06 | mr1556 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 5.27E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 4.19E-13 | mr1789 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | 8.25E-07 | 6.02E-07 | mr1797 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | 8.25E-07 | 6.02E-07 | mr1801 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410214235 | NA | 1.33E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |