Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0410180309:

Variant ID: vg0410180309 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10180309
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGTCGCGTGGTGGTAAGGATCCGTCCTCTCGCTGCCCCGTCCTCGTCCTTTCGGTGTCGCCCGTGCCCGTTGTGCGGTTGTCGACCCCGGTACCCGTG[C/T]
ACCGGTGTCGGTAGTCGTCCATGTGTGCGCGTGGTGACCGTGTTAGTGTGTCCGCTCGGTAGCCGCGTGGTTTCCACGTGTGCAACCCGTGTGGTGTCTA

Reverse complement sequence

TAGACACCACACGGGTTGCACACGTGGAAACCACGCGGCTACCGAGCGGACACACTAACACGGTCACCACGCGCACACATGGACGACTACCGACACCGGT[G/A]
CACGGGTACCGGGGTCGACAACCGCACAACGGGCACGGGCGACACCGAAAGGACGAGGACGGGGCAGCGAGAGGACGGATCCTTACCACCACGCGACGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	45.40%	7.81%	0.00%	NA
All Indica	2759	69.30%	26.10%	4.57%	0.00%	NA
All Japonica	1512	1.70%	86.20%	12.10%	0.00%	NA
Aus	269	74.00%	19.30%	6.69%	0.00%	NA
Indica I	595	44.00%	51.40%	4.54%	0.00%	NA
Indica II	465	68.00%	29.00%	3.01%	0.00%	NA
Indica III	913	88.20%	6.10%	5.70%	0.00%	NA
Indica Intermediate	786	67.40%	28.40%	4.20%	0.00%	NA
Temperate Japonica	767	0.40%	98.40%	1.17%	0.00%	NA
Tropical Japonica	504	3.60%	65.70%	30.75%	0.00%	NA
Japonica Intermediate	241	1.70%	90.50%	7.88%	0.00%	NA
VI/Aromatic	96	43.80%	20.80%	35.42%	0.00%	NA
Intermediate	90	34.40%	56.70%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410180309	C -> T	LOC_Os04g18420.1	upstream_gene_variant ; 4289.0bp to feature; MODIFIER	silent_mutation	Average:20.854; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0410180309	C -> T	LOC_Os04g18430.1	upstream_gene_variant ; 443.0bp to feature; MODIFIER	silent_mutation	Average:20.854; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0410180309	C -> T	LOC_Os04g18440.1	upstream_gene_variant ; 3526.0bp to feature; MODIFIER	silent_mutation	Average:20.854; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N
vg0410180309	C -> T	LOC_Os04g18430-LOC_Os04g18440	intergenic_region ; MODIFIER	silent_mutation	Average:20.854; most accessible tissue: Zhenshan97 flag leaf, score: 40.929	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410180309	5.05E-07	2.90E-07	mr1029	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	4.27E-06	NA	mr1029	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	2.52E-06	3.08E-10	mr1047	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	5.07E-06	2.08E-07	mr1189	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	8.31E-06	8.95E-07	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	9.38E-06	1.08E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	NA	2.46E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	NA	2.02E-08	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	4.26E-06	NA	mr1796	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	5.49E-06	5.49E-06	mr1834	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	1.41E-06	1.41E-06	mr1834	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410180309	NA	1.50E-07	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251