\
| Variant ID: vg0410128864 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10128864 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACCCTGAAATTAAAATTATACAAAAACGGAATGTACTCATCCCAAAGGTAAAATGGAATGTACTCGTTCCAAAGGTTCCGTTTTTGCCAACGGATCACCA[A/G]
TCCGACACTTGAAAAATTTTCACCAAGCTATGTGGGAAGACACGGTATGGATCTAAACCGAGAGAAAAAAAGAGGGAGGGAGTCGGACTCGCCTCCTCTC
GAGAGGAGGCGAGTCCGACTCCCTCCCTCTTTTTTTCTCTCGGTTTAGATCCATACCGTGTCTTCCCACATAGCTTGGTGAAAATTTTTCAAGTGTCGGA[T/C]
TGGTGATCCGTTGGCAAAAACGGAACCTTTGGAACGAGTACATTCCATTTTACCTTTGGGATGAGTACATTCCGTTTTTGTATAATTTTAATTTCAGGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 2.10% | 5.67% | 56.79% | NA |
| All Indica | 2759 | 8.40% | 0.00% | 5.44% | 86.08% | NA |
| All Japonica | 1512 | 85.80% | 6.30% | 7.08% | 0.86% | NA |
| Aus | 269 | 4.50% | 0.00% | 2.23% | 93.31% | NA |
| Indica I | 595 | 4.90% | 0.00% | 8.07% | 87.06% | NA |
| Indica II | 465 | 6.00% | 0.00% | 4.09% | 89.89% | NA |
| Indica III | 913 | 12.70% | 0.00% | 5.48% | 81.82% | NA |
| Indica Intermediate | 786 | 7.60% | 0.10% | 4.20% | 88.04% | NA |
| Temperate Japonica | 767 | 76.70% | 11.00% | 12.13% | 0.26% | NA |
| Tropical Japonica | 504 | 97.20% | 1.60% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 90.90% | 1.20% | 5.81% | 2.07% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 0.00% | 11.46% | NA |
| Intermediate | 90 | 53.30% | 3.30% | 5.56% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410128864 | A -> DEL | N | N | silent_mutation | Average:9.623; most accessible tissue: Callus, score: 31.455 | N | N | N | N |
| vg0410128864 | A -> G | LOC_Os04g18350.1 | upstream_gene_variant ; 2265.0bp to feature; MODIFIER | silent_mutation | Average:9.623; most accessible tissue: Callus, score: 31.455 | N | N | N | N |
| vg0410128864 | A -> G | LOC_Os04g18360.1 | downstream_gene_variant ; 3415.0bp to feature; MODIFIER | silent_mutation | Average:9.623; most accessible tissue: Callus, score: 31.455 | N | N | N | N |
| vg0410128864 | A -> G | LOC_Os04g18340.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.623; most accessible tissue: Callus, score: 31.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410128864 | 1.67E-06 | NA | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | NA | 5.88E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 3.19E-09 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 2.36E-06 | 1.73E-11 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 9.01E-09 | 2.20E-10 | mr1525 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 1.85E-08 | 1.85E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 7.46E-06 | NA | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | NA | 4.14E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 3.18E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 4.76E-09 | NA | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 5.95E-07 | 1.99E-10 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 3.55E-08 | 3.54E-08 | mr1525_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 4.04E-06 | 4.04E-06 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | 5.06E-07 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410128864 | NA | 4.02E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |