\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410126275:

Variant ID: vg0410126275 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10126275
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAACACAAGAAACTCTAACTATCTAAATAAAGGTGTGAGGATGACCAAGTGGACCCTAGGGTCGTGCTCCTCCTGGTTGAGGCGCACCCCATATGGGCC[C/G]
CACTTGGGCGGGGGTCCCAAACGAAGTTACAAGCCCAAAGGCCCATGACAGGTGACGCAACACCTTGTTTTTGTGTTTGCGGCCAAACGAGATGGAGTCT

Reverse complement sequence

AGACTCCATCTCGTTTGGCCGCAAACACAAAAACAAGGTGTTGCGTCACCTGTCATGGGCCTTTGGGCTTGTAACTTCGTTTGGGACCCCCGCCCAAGTG[G/C]
GGCCCATATGGGGTGCGCCTCAACCAGGAGGAGCACGACCCTAGGGTCCACTTGGTCATCCTCACACCTTTATTTAGATAGTTAGAGTTTCTTGTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 0.10% 10.88% 5.01% NA
All Indica  2759 78.80% 0.10% 16.85% 4.20% NA
All Japonica  1512 99.70% 0.00% 0.26% 0.07% NA
Aus  269 45.70% 0.70% 13.01% 40.52% NA
Indica I  595 77.60% 0.20% 19.83% 2.35% NA
Indica II  465 72.00% 0.20% 25.81% 1.94% NA
Indica III  913 83.80% 0.10% 9.86% 6.24% NA
Indica Intermediate  786 78.00% 0.00% 17.43% 4.58% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.60% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 0.00% 2.08% 8.33% NA
Intermediate  90 87.80% 0.00% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410126275 C -> DEL LOC_Os04g18340.1 N frameshift_variant Average:19.472; most accessible tissue: Callus, score: 42.891 N N N N
vg0410126275 C -> G LOC_Os04g18340.1 missense_variant ; p.Gly355Ala; MODERATE nonsynonymous_codon ; G355A Average:19.472; most accessible tissue: Callus, score: 42.891 possibly damaging 1.557 TOLERATED 0.10

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410126275 NA 3.12E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 3.31E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 3.99E-07 6.97E-15 mr1034 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 3.92E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 4.78E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 6.97E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 4.55E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410126275 NA 4.14E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251