\
| Variant ID: vg0410126275 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10126275 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAACACAAGAAACTCTAACTATCTAAATAAAGGTGTGAGGATGACCAAGTGGACCCTAGGGTCGTGCTCCTCCTGGTTGAGGCGCACCCCATATGGGCC[C/G]
CACTTGGGCGGGGGTCCCAAACGAAGTTACAAGCCCAAAGGCCCATGACAGGTGACGCAACACCTTGTTTTTGTGTTTGCGGCCAAACGAGATGGAGTCT
AGACTCCATCTCGTTTGGCCGCAAACACAAAAACAAGGTGTTGCGTCACCTGTCATGGGCCTTTGGGCTTGTAACTTCGTTTGGGACCCCCGCCCAAGTG[G/C]
GGCCCATATGGGGTGCGCCTCAACCAGGAGGAGCACGACCCTAGGGTCCACTTGGTCATCCTCACACCTTTATTTAGATAGTTAGAGTTTCTTGTGTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.00% | 0.10% | 10.88% | 5.01% | NA |
| All Indica | 2759 | 78.80% | 0.10% | 16.85% | 4.20% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.26% | 0.07% | NA |
| Aus | 269 | 45.70% | 0.70% | 13.01% | 40.52% | NA |
| Indica I | 595 | 77.60% | 0.20% | 19.83% | 2.35% | NA |
| Indica II | 465 | 72.00% | 0.20% | 25.81% | 1.94% | NA |
| Indica III | 913 | 83.80% | 0.10% | 9.86% | 6.24% | NA |
| Indica Intermediate | 786 | 78.00% | 0.00% | 17.43% | 4.58% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 8.89% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410126275 | C -> DEL | LOC_Os04g18340.1 | N | frameshift_variant | Average:19.472; most accessible tissue: Callus, score: 42.891 | N | N | N | N |
| vg0410126275 | C -> G | LOC_Os04g18340.1 | missense_variant ; p.Gly355Ala; MODERATE | nonsynonymous_codon ; G355A | Average:19.472; most accessible tissue: Callus, score: 42.891 | possibly damaging |
1.557 |
TOLERATED | 0.10 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410126275 | NA | 3.12E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 3.31E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | 3.99E-07 | 6.97E-15 | mr1034 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 3.92E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 4.78E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 6.97E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 4.55E-06 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410126275 | NA | 4.14E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |