Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410108987:

Variant ID: vg0410108987 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10108987
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCGTAGGCTAGCCCGTTCTGTGGCAAGCCTAATGAGGATGCCAATGCTCATCTCCAACAGTTCCTGGAGATCTGTAGCACATACACCATCCAGGGCGT[C/T]
AGTCCCAACGCTGTCAGGCTGTGGCTGTTTCTGTTCTCCCTCCTTGGGAGAGCAAAGCAGTGGTTCTATGCCAACCGTAATGTTGTCAATACCTAGGATA

Reverse complement sequence

TATCCTAGGTATTGACAACATTACGGTTGGCATAGAACCACTGCTTTGCTCTCCCAAGGAGGGAGAACAGAAACAGCCACAGCCTGACAGCGTTGGGACT[G/A]
ACGCCCTGGATGGTGTATGTGCTACAGATCTCCAGGAACTGTTGGAGATGAGCATTGGCATCCTCATTAGGCTTGCCACAGAACGGGCTAGCCTACGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	20.50%	0.55%	13.39%	NA
All Indica	2759	98.90%	0.70%	0.11%	0.36%	NA
All Japonica	1512	2.10%	61.20%	1.32%	35.38%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	97.80%	1.10%	0.00%	1.08%	NA
Indica III	913	99.50%	0.20%	0.11%	0.22%	NA
Indica Intermediate	786	98.50%	0.90%	0.25%	0.38%	NA
Temperate Japonica	767	0.40%	96.00%	0.13%	3.52%	NA
Tropical Japonica	504	3.60%	5.00%	3.77%	87.70%	NA
Japonica Intermediate	241	4.60%	68.00%	0.00%	27.39%	NA
VI/Aromatic	96	21.90%	2.10%	3.12%	72.92%	NA
Intermediate	90	55.60%	24.40%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410108987	C -> DEL	N	N	silent_mutation	Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg0410108987	C -> T	LOC_Os04g18300.1	upstream_gene_variant ; 1556.0bp to feature; MODIFIER	silent_mutation	Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg0410108987	C -> T	LOC_Os04g18320.1	upstream_gene_variant ; 3373.0bp to feature; MODIFIER	silent_mutation	Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg0410108987	C -> T	LOC_Os04g18290.1	downstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg0410108987	C -> T	LOC_Os04g18310.1	intron_variant ; MODIFIER	silent_mutation	Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410108987	NA	5.64E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.04E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.50E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	6.33E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	9.08E-07	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	8.41E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	7.02E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	2.43E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.30E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	6.12E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.27E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.64E-30	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.42E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	9.41E-06	mr1144_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	2.03E-06	6.63E-07	mr1239_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.52E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	4.36E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	1.65E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	4.36E-30	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	6.08E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987	NA	9.42E-42	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251