\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410108987:

Variant ID: vg0410108987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10108987
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCGTAGGCTAGCCCGTTCTGTGGCAAGCCTAATGAGGATGCCAATGCTCATCTCCAACAGTTCCTGGAGATCTGTAGCACATACACCATCCAGGGCGT[C/T]
AGTCCCAACGCTGTCAGGCTGTGGCTGTTTCTGTTCTCCCTCCTTGGGAGAGCAAAGCAGTGGTTCTATGCCAACCGTAATGTTGTCAATACCTAGGATA

Reverse complement sequence

TATCCTAGGTATTGACAACATTACGGTTGGCATAGAACCACTGCTTTGCTCTCCCAAGGAGGGAGAACAGAAACAGCCACAGCCTGACAGCGTTGGGACT[G/A]
ACGCCCTGGATGGTGTATGTGCTACAGATCTCCAGGAACTGTTGGAGATGAGCATTGGCATCCTCATTAGGCTTGCCACAGAACGGGCTAGCCTACGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 20.50% 0.55% 13.39% NA
All Indica  2759 98.90% 0.70% 0.11% 0.36% NA
All Japonica  1512 2.10% 61.20% 1.32% 35.38% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.80% 1.10% 0.00% 1.08% NA
Indica III  913 99.50% 0.20% 0.11% 0.22% NA
Indica Intermediate  786 98.50% 0.90% 0.25% 0.38% NA
Temperate Japonica  767 0.40% 96.00% 0.13% 3.52% NA
Tropical Japonica  504 3.60% 5.00% 3.77% 87.70% NA
Japonica Intermediate  241 4.60% 68.00% 0.00% 27.39% NA
VI/Aromatic  96 21.90% 2.10% 3.12% 72.92% NA
Intermediate  90 55.60% 24.40% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410108987 C -> DEL N N silent_mutation Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0410108987 C -> T LOC_Os04g18300.1 upstream_gene_variant ; 1556.0bp to feature; MODIFIER silent_mutation Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0410108987 C -> T LOC_Os04g18320.1 upstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0410108987 C -> T LOC_Os04g18290.1 downstream_gene_variant ; 2805.0bp to feature; MODIFIER silent_mutation Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0410108987 C -> T LOC_Os04g18310.1 intron_variant ; MODIFIER silent_mutation Average:59.265; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410108987 NA 5.64E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.04E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.50E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 6.33E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 9.08E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 8.41E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 7.02E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 2.43E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.30E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 6.12E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.27E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.64E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.42E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 9.41E-06 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 2.03E-06 6.63E-07 mr1239_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.52E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 4.36E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 1.65E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 4.36E-30 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 6.08E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410108987 NA 9.42E-42 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251