\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410076881:

Variant ID: vg0410076881 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10076881
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGAAATTCCTTAATCCTAAAATTTCGGTATCTTACAGTAAAAGTAGCAAATATTTTAATTGGACCCCTCCTTGGCCCCACCCCCAAGGCTCCAGCCC[G/A]
CGGTGCCGCTATCCCTTCCATCGCCTGCTTGCCCCCTCCTTCGCCCAACCTTTAGGGCGCCGTCGTACGCACTCCCCAAGCAAACCCTAATCGCCGCTGC

Reverse complement sequence

GCAGCGGCGATTAGGGTTTGCTTGGGGAGTGCGTACGACGGCGCCCTAAAGGTTGGGCGAAGGAGGGGGCAAGCAGGCGATGGAAGGGATAGCGGCACCG[C/T]
GGGCTGGAGCCTTGGGGGTGGGGCCAAGGAGGGGTCCAATTAAAATATTTGCTACTTTTACTGTAAGATACCGAAATTTTAGGATTAAGGAATTTCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 2.00% 2.90% 0.00% NA
All Indica  2759 91.70% 3.50% 4.86% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 71.60% 10.90% 17.48% 0.00% NA
Indica II  465 98.70% 0.00% 1.29% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 2.80% 3.05% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410076881 G -> A LOC_Os04g18230.1 downstream_gene_variant ; 2180.0bp to feature; MODIFIER silent_mutation Average:70.561; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N
vg0410076881 G -> A LOC_Os04g18200-LOC_Os04g18230 intergenic_region ; MODIFIER silent_mutation Average:70.561; most accessible tissue: Zhenshan97 young leaf, score: 84.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410076881 NA 7.96E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410076881 4.93E-06 4.94E-06 mr1355 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410076881 NA 6.73E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410076881 NA 1.46E-08 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410076881 NA 1.06E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410076881 NA 3.20E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251