\
| Variant ID: vg0410076881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10076881 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATGGAAATTCCTTAATCCTAAAATTTCGGTATCTTACAGTAAAAGTAGCAAATATTTTAATTGGACCCCTCCTTGGCCCCACCCCCAAGGCTCCAGCCC[G/A]
CGGTGCCGCTATCCCTTCCATCGCCTGCTTGCCCCCTCCTTCGCCCAACCTTTAGGGCGCCGTCGTACGCACTCCCCAAGCAAACCCTAATCGCCGCTGC
GCAGCGGCGATTAGGGTTTGCTTGGGGAGTGCGTACGACGGCGCCCTAAAGGTTGGGCGAAGGAGGGGGCAAGCAGGCGATGGAAGGGATAGCGGCACCG[C/T]
GGGCTGGAGCCTTGGGGGTGGGGCCAAGGAGGGGTCCAATTAAAATATTTGCTACTTTTACTGTAAGATACCGAAATTTTAGGATTAAGGAATTTCCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 2.00% | 2.90% | 0.00% | NA |
| All Indica | 2759 | 91.70% | 3.50% | 4.86% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 71.60% | 10.90% | 17.48% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.00% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 2.80% | 3.05% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410076881 | G -> A | LOC_Os04g18230.1 | downstream_gene_variant ; 2180.0bp to feature; MODIFIER | silent_mutation | Average:70.561; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
| vg0410076881 | G -> A | LOC_Os04g18200-LOC_Os04g18230 | intergenic_region ; MODIFIER | silent_mutation | Average:70.561; most accessible tissue: Zhenshan97 young leaf, score: 84.624 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410076881 | NA | 7.96E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410076881 | 4.93E-06 | 4.94E-06 | mr1355 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410076881 | NA | 6.73E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410076881 | NA | 1.46E-08 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410076881 | NA | 1.06E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410076881 | NA | 3.20E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |