\
| Variant ID: vg0410073312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10073312 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 127. )
AATTTTTAGAGTTAATATGAATTCTTTATGTATTTTACAAGTTATAACATGTTATAGGTGTATAGTGTTATATAGGTTCATGGCTTTAGAGGTTTAGGTC[C/T]
AGAACTTGCCTCATCTAGCCAGTGATGTATAAAATGAGTATTTTAGTTAACTAATCTAATCTTAGTTCATAATTTTAGAGTTTATATTATTTTACTACAC
GTGTAGTAAAATAATATAAACTCTAAAATTATGAACTAAGATTAGATTAGTTAACTAAAATACTCATTTTATACATCACTGGCTAGATGAGGCAAGTTCT[G/A]
GACCTAAACCTCTAAAGCCATGAACCTATATAACACTATACACCTATAACATGTTATAACTTGTAAAATACATAAAGAATTCATATTAACTCTAAAAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 27.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 53.70% | 46.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.30% | 40.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 57.30% | 42.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410073312 | C -> T | LOC_Os04g18200-LOC_Os04g18230 | intergenic_region ; MODIFIER | silent_mutation | Average:45.798; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410073312 | NA | 1.47E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | NA | 7.19E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | NA | 3.75E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | NA | 3.29E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | NA | 4.08E-08 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 4.03E-09 | NA | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 4.97E-09 | 1.20E-13 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 1.05E-06 | NA | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 3.78E-06 | 3.62E-12 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 1.58E-14 | 4.84E-16 | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410073312 | 7.73E-13 | 1.20E-28 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |