\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410042047:

Variant ID: vg0410042047 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10042047
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGGGTCCCCTTACTCAGCCATATATTGTTTACCGTATGCCATTGATAACTTGGGTATCAAAATGATTAGATGTTGGTTTAGGAAATGCTTAGCCAT[A/G]
CTTAGTTTAACTAGTACACAAATGGGGATCACATTATTACATAGATTTTGACTATTAGCATAGCTTTGGATTTGTACCACCGCAATGGTGTTAGTTAATT

Reverse complement sequence

AATTAACTAACACCATTGCGGTGGTACAAATCCAAAGCTATGCTAATAGTCAAAATCTATGTAATAATGTGATCCCCATTTGTGTACTAGTTAAACTAAG[T/C]
ATGGCTAAGCATTTCCTAAACCAACATCTAATCATTTTGATACCCAAGTTATCAATGGCATACGGTAAACAATATATGGCTGAGTAAGGGGACCCCTCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.20% 12.60% 13.50% 51.71% NA
All Indica  2759 3.10% 1.60% 15.69% 79.56% NA
All Japonica  1512 61.70% 34.20% 3.31% 0.79% NA
Aus  269 2.20% 3.30% 23.42% 71.00% NA
Indica I  595 2.40% 1.00% 9.41% 87.23% NA
Indica II  465 3.70% 1.90% 9.25% 85.16% NA
Indica III  913 2.70% 2.00% 24.75% 70.54% NA
Indica Intermediate  786 3.80% 1.50% 13.74% 80.92% NA
Temperate Japonica  767 96.00% 3.40% 0.26% 0.39% NA
Tropical Japonica  504 6.30% 85.10% 7.54% 0.99% NA
Japonica Intermediate  241 68.50% 25.70% 4.15% 1.66% NA
VI/Aromatic  96 3.10% 9.40% 79.17% 8.33% NA
Intermediate  90 23.30% 16.70% 17.78% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410042047 A -> DEL N N silent_mutation Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0410042047 A -> G LOC_Os04g18170.1 upstream_gene_variant ; 2556.0bp to feature; MODIFIER silent_mutation Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0410042047 A -> G LOC_Os04g18160.1 downstream_gene_variant ; 2041.0bp to feature; MODIFIER silent_mutation Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0410042047 A -> G LOC_Os04g18160-LOC_Os04g18170 intergenic_region ; MODIFIER silent_mutation Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410042047 NA 2.03E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.39E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.27E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 2.77E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.14E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.52E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 4.65E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.43E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.81E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 4.64E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 7.80E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 7.68E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.91E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.92E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 5.10E-06 5.10E-06 mr1463 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 7.92E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 1.34E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.83E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.10E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 2.50E-06 2.50E-06 mr1703 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 5.95E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.81E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 7.71E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 9.87E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 3.39E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 2.47E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 2.64E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 4.31E-06 4.94E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 8.66E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 2.57E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 9.87E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410042047 NA 5.14E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251