\
| Variant ID: vg0410042047 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10042047 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 113. )
GGGAGGGGTCCCCTTACTCAGCCATATATTGTTTACCGTATGCCATTGATAACTTGGGTATCAAAATGATTAGATGTTGGTTTAGGAAATGCTTAGCCAT[A/G]
CTTAGTTTAACTAGTACACAAATGGGGATCACATTATTACATAGATTTTGACTATTAGCATAGCTTTGGATTTGTACCACCGCAATGGTGTTAGTTAATT
AATTAACTAACACCATTGCGGTGGTACAAATCCAAAGCTATGCTAATAGTCAAAATCTATGTAATAATGTGATCCCCATTTGTGTACTAGTTAAACTAAG[T/C]
ATGGCTAAGCATTTCCTAAACCAACATCTAATCATTTTGATACCCAAGTTATCAATGGCATACGGTAAACAATATATGGCTGAGTAAGGGGACCCCTCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.20% | 12.60% | 13.50% | 51.71% | NA |
| All Indica | 2759 | 3.10% | 1.60% | 15.69% | 79.56% | NA |
| All Japonica | 1512 | 61.70% | 34.20% | 3.31% | 0.79% | NA |
| Aus | 269 | 2.20% | 3.30% | 23.42% | 71.00% | NA |
| Indica I | 595 | 2.40% | 1.00% | 9.41% | 87.23% | NA |
| Indica II | 465 | 3.70% | 1.90% | 9.25% | 85.16% | NA |
| Indica III | 913 | 2.70% | 2.00% | 24.75% | 70.54% | NA |
| Indica Intermediate | 786 | 3.80% | 1.50% | 13.74% | 80.92% | NA |
| Temperate Japonica | 767 | 96.00% | 3.40% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 6.30% | 85.10% | 7.54% | 0.99% | NA |
| Japonica Intermediate | 241 | 68.50% | 25.70% | 4.15% | 1.66% | NA |
| VI/Aromatic | 96 | 3.10% | 9.40% | 79.17% | 8.33% | NA |
| Intermediate | 90 | 23.30% | 16.70% | 17.78% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410042047 | A -> DEL | N | N | silent_mutation | Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0410042047 | A -> G | LOC_Os04g18170.1 | upstream_gene_variant ; 2556.0bp to feature; MODIFIER | silent_mutation | Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0410042047 | A -> G | LOC_Os04g18160.1 | downstream_gene_variant ; 2041.0bp to feature; MODIFIER | silent_mutation | Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0410042047 | A -> G | LOC_Os04g18160-LOC_Os04g18170 | intergenic_region ; MODIFIER | silent_mutation | Average:39.903; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410042047 | NA | 2.03E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.39E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.27E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 2.77E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.14E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.52E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 4.65E-11 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.43E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.81E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 4.64E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 7.80E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 7.68E-06 | mr1378 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.91E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.92E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | 5.10E-06 | 5.10E-06 | mr1463 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 7.92E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 1.34E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.83E-09 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.10E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | 2.50E-06 | 2.50E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 5.95E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.81E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 7.71E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 9.87E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 3.39E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 2.47E-12 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 2.64E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | 4.31E-06 | 4.94E-08 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 8.66E-10 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 2.57E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 9.87E-16 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410042047 | NA | 5.14E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |