Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409862324:

Variant ID: vg0409862324 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9862324
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAAGTTTAGAAACCACCAAAACATGATTCTTGGACATATTGGAGTGTATTGGGTGCAATCGTTGCAAAAAGTCACTTCGTGATTCGCGCGGCGATC[T/G]
TTTGTCACTTCAAGAAGCACCAAAACAATTTTTTGGACATATTATAAGTGTATTGGGTGCGTTCGTGGCAAAAAGTCACTTCGTGATTCGCGCGGTGATG

Reverse complement sequence

CATCACCGCGCGAATCACGAAGTGACTTTTTGCCACGAACGCACCCAATACACTTATAATATGTCCAAAAAATTGTTTTGGTGCTTCTTGAAGTGACAAA[A/C]
GATCGCCGCGCGAATCACGAAGTGACTTTTTGCAACGATTGCACCCAATACACTCCAATATGTCCAAGAATCATGTTTTGGTGGTTTCTAAACTTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.20%	0.70%	1.33%	13.82%	NA
All Indica	2759	97.10%	1.10%	1.38%	0.40%	NA
All Japonica	1512	62.50%	0.10%	0.66%	36.77%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	98.20%	1.00%	0.84%	0.00%	NA
Indica II	465	95.90%	1.50%	1.51%	1.08%	NA
Indica III	913	97.70%	0.90%	1.20%	0.22%	NA
Indica Intermediate	786	96.40%	1.10%	1.91%	0.51%	NA
Temperate Japonica	767	96.30%	0.00%	0.00%	3.65%	NA
Tropical Japonica	504	6.50%	0.20%	1.39%	91.87%	NA
Japonica Intermediate	241	71.80%	0.00%	1.24%	26.97%	NA
VI/Aromatic	96	20.80%	0.00%	10.42%	68.75%	NA
Intermediate	90	74.40%	1.10%	2.22%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409862324	T -> DEL	N	N	silent_mutation	Average:21.963; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862324	T -> G	LOC_Os04g17940.1	downstream_gene_variant ; 76.0bp to feature; MODIFIER	silent_mutation	Average:21.963; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862324	T -> G	LOC_Os04g17930-LOC_Os04g17940	intergenic_region ; MODIFIER	silent_mutation	Average:21.963; most accessible tissue: Callus, score: 34.743	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409862324	NA	1.60E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	3.56E-06	3.56E-06	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	6.14E-07	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	8.41E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	2.93E-07	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	4.87E-07	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	1.75E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	8.57E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862324	NA	1.82E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251