\
| Variant ID: vg0409862324 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9862324 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGAAAAAGTTTAGAAACCACCAAAACATGATTCTTGGACATATTGGAGTGTATTGGGTGCAATCGTTGCAAAAAGTCACTTCGTGATTCGCGCGGCGATC[T/G]
TTTGTCACTTCAAGAAGCACCAAAACAATTTTTTGGACATATTATAAGTGTATTGGGTGCGTTCGTGGCAAAAAGTCACTTCGTGATTCGCGCGGTGATG
CATCACCGCGCGAATCACGAAGTGACTTTTTGCCACGAACGCACCCAATACACTTATAATATGTCCAAAAAATTGTTTTGGTGCTTCTTGAAGTGACAAA[A/C]
GATCGCCGCGCGAATCACGAAGTGACTTTTTGCAACGATTGCACCCAATACACTCCAATATGTCCAAGAATCATGTTTTGGTGGTTTCTAAACTTTTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.20% | 0.70% | 1.33% | 13.82% | NA |
| All Indica | 2759 | 97.10% | 1.10% | 1.38% | 0.40% | NA |
| All Japonica | 1512 | 62.50% | 0.10% | 0.66% | 36.77% | NA |
| Aus | 269 | 98.50% | 0.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 95.90% | 1.50% | 1.51% | 1.08% | NA |
| Indica III | 913 | 97.70% | 0.90% | 1.20% | 0.22% | NA |
| Indica Intermediate | 786 | 96.40% | 1.10% | 1.91% | 0.51% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 6.50% | 0.20% | 1.39% | 91.87% | NA |
| Japonica Intermediate | 241 | 71.80% | 0.00% | 1.24% | 26.97% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 10.42% | 68.75% | NA |
| Intermediate | 90 | 74.40% | 1.10% | 2.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409862324 | T -> DEL | N | N | silent_mutation | Average:21.963; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862324 | T -> G | LOC_Os04g17940.1 | downstream_gene_variant ; 76.0bp to feature; MODIFIER | silent_mutation | Average:21.963; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862324 | T -> G | LOC_Os04g17930-LOC_Os04g17940 | intergenic_region ; MODIFIER | silent_mutation | Average:21.963; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409862324 | NA | 1.60E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | 3.56E-06 | 3.56E-06 | mr1068 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 6.14E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 8.41E-06 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 2.93E-07 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 4.87E-07 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 1.75E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 8.57E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862324 | NA | 1.82E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |