\
| Variant ID: vg0409862256 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9862256 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 68. )
TCGCGCGGCGATCTTTTGTCAATTAATGCCAATATTGGCACACGTGGGTGCGATGTTTTTGACCGGAATGAAAAAGTTTAGAAACCACCAAAACATGATT[C/T,G]
TTGGACATATTGGAGTGTATTGGGTGCAATCGTTGCAAAAAGTCACTTCGTGATTCGCGCGGCGATCTTTTGTCACTTCAAGAAGCACCAAAACAATTTT
AAAATTGTTTTGGTGCTTCTTGAAGTGACAAAAGATCGCCGCGCGAATCACGAAGTGACTTTTTGCAACGATTGCACCCAATACACTCCAATATGTCCAA[G/A,C]
AATCATGTTTTGGTGGTTTCTAAACTTTTTCATTCCGGTCAAAAACATCGCACCCACGTGTGCCAATATTGGCATTAATTGACAAAAGATCGCCGCGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.60% | 7.70% | 27.15% | 44.54% | NA |
| All Indica | 2759 | 1.20% | 12.30% | 38.75% | 47.84% | NA |
| All Japonica | 1512 | 61.00% | 0.30% | 0.66% | 38.10% | NA |
| Aus | 269 | 0.40% | 4.80% | 60.22% | 34.57% | NA |
| Indica I | 595 | 0.30% | 5.00% | 30.42% | 64.20% | NA |
| Indica II | 465 | 1.30% | 27.50% | 32.47% | 38.71% | NA |
| Indica III | 913 | 1.20% | 12.00% | 46.55% | 40.20% | NA |
| Indica Intermediate | 786 | 1.70% | 8.90% | 39.69% | 49.75% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 4.40% | 0.40% | 0.99% | 94.25% | NA |
| Japonica Intermediate | 241 | 68.00% | 0.80% | 1.66% | 29.46% | NA |
| VI/Aromatic | 96 | 0.00% | 3.10% | 16.67% | 80.21% | NA |
| Intermediate | 90 | 22.20% | 5.60% | 28.89% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409862256 | C -> DEL | N | N | silent_mutation | Average:25.28; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862256 | C -> G | LOC_Os04g17940.1 | downstream_gene_variant ; 144.0bp to feature; MODIFIER | N | Average:25.28; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862256 | C -> G | LOC_Os04g17930-LOC_Os04g17940 | intergenic_region ; MODIFIER | N | Average:25.28; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862256 | C -> T | LOC_Os04g17940.1 | downstream_gene_variant ; 144.0bp to feature; MODIFIER | silent_mutation | Average:25.28; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| vg0409862256 | C -> T | LOC_Os04g17930-LOC_Os04g17940 | intergenic_region ; MODIFIER | silent_mutation | Average:25.28; most accessible tissue: Callus, score: 34.743 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409862256 | NA | 5.04E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | NA | 2.35E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | 1.39E-06 | NA | mr1275 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | 5.18E-07 | NA | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | NA | 3.75E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | NA | 1.04E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | NA | 1.28E-37 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409862256 | NA | 2.43E-69 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |