Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409862256:

Variant ID: vg0409862256 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9862256
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCGCGGCGATCTTTTGTCAATTAATGCCAATATTGGCACACGTGGGTGCGATGTTTTTGACCGGAATGAAAAAGTTTAGAAACCACCAAAACATGATT[C/T,G]
TTGGACATATTGGAGTGTATTGGGTGCAATCGTTGCAAAAAGTCACTTCGTGATTCGCGCGGCGATCTTTTGTCACTTCAAGAAGCACCAAAACAATTTT

Reverse complement sequence

AAAATTGTTTTGGTGCTTCTTGAAGTGACAAAAGATCGCCGCGCGAATCACGAAGTGACTTTTTGCAACGATTGCACCCAATACACTCCAATATGTCCAA[G/A,C]
AATCATGTTTTGGTGGTTTCTAAACTTTTTCATTCCGGTCAAAAACATCGCACCCACGTGTGCCAATATTGGCATTAATTGACAAAAGATCGCCGCGCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.60%	7.70%	27.15%	44.54%	NA
All Indica	2759	1.20%	12.30%	38.75%	47.84%	NA
All Japonica	1512	61.00%	0.30%	0.66%	38.10%	NA
Aus	269	0.40%	4.80%	60.22%	34.57%	NA
Indica I	595	0.30%	5.00%	30.42%	64.20%	NA
Indica II	465	1.30%	27.50%	32.47%	38.71%	NA
Indica III	913	1.20%	12.00%	46.55%	40.20%	NA
Indica Intermediate	786	1.70%	8.90%	39.69%	49.75%	NA
Temperate Japonica	767	96.00%	0.00%	0.13%	3.91%	NA
Tropical Japonica	504	4.40%	0.40%	0.99%	94.25%	NA
Japonica Intermediate	241	68.00%	0.80%	1.66%	29.46%	NA
VI/Aromatic	96	0.00%	3.10%	16.67%	80.21%	NA
Intermediate	90	22.20%	5.60%	28.89%	43.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409862256	C -> DEL	N	N	silent_mutation	Average:25.28; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862256	C -> G	LOC_Os04g17940.1	downstream_gene_variant ; 144.0bp to feature; MODIFIER	N	Average:25.28; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862256	C -> G	LOC_Os04g17930-LOC_Os04g17940	intergenic_region ; MODIFIER	N	Average:25.28; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862256	C -> T	LOC_Os04g17940.1	downstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:25.28; most accessible tissue: Callus, score: 34.743	N	N	N	N
vg0409862256	C -> T	LOC_Os04g17930-LOC_Os04g17940	intergenic_region ; MODIFIER	silent_mutation	Average:25.28; most accessible tissue: Callus, score: 34.743	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409862256	NA	5.04E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	NA	2.35E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	1.39E-06	NA	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	5.18E-07	NA	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	NA	3.75E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	NA	1.04E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	NA	1.28E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409862256	NA	2.43E-69	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251