\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409860484:

Variant ID: vg0409860484 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9860484
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCGGAATGAAAAAGTTCAAAAAGCACCAAAACTTGATTCTTGGAGAAACTGGAGTGTATTGGGTGTGTTCGTGGCAAAAAATCACTTCGTGATTCGC[G/A]
CGGTGAACTTTTGTCAATTAACGCCAATATTGGCACACGTGGGTGCGATGTTTTCGACCGGAACAAAAAAGTTCAAAAAGCACCAAAACATGATTTTCGG

Reverse complement sequence

CCGAAAATCATGTTTTGGTGCTTTTTGAACTTTTTTGTTCCGGTCGAAAACATCGCACCCACGTGTGCCAATATTGGCGTTAATTGACAAAAGTTCACCG[C/T]
GCGAATCACGAAGTGATTTTTTGCCACGAACACACCCAATACACTCCAGTTTCTCCAAGAATCAAGTTTTGGTGCTTTTTGAACTTTTTCATTCCGGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 23.00% 1.71% 15.09% NA
All Indica  2759 95.50% 0.90% 0.14% 3.48% NA
All Japonica  1512 1.70% 67.50% 3.70% 27.18% NA
Aus  269 49.10% 1.90% 1.49% 47.58% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 96.30% 2.40% 0.00% 1.29% NA
Indica III  913 92.60% 0.40% 0.22% 6.79% NA
Indica Intermediate  786 95.30% 0.90% 0.25% 3.56% NA
Temperate Japonica  767 0.40% 96.50% 0.26% 2.87% NA
Tropical Japonica  504 2.40% 20.20% 8.93% 68.45% NA
Japonica Intermediate  241 4.10% 73.90% 3.73% 18.26% NA
VI/Aromatic  96 8.30% 14.60% 13.54% 63.54% NA
Intermediate  90 51.10% 25.60% 4.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409860484 G -> DEL N N silent_mutation Average:31.351; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0409860484 G -> A LOC_Os04g17930.1 upstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:31.351; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0409860484 G -> A LOC_Os04g17940.1 downstream_gene_variant ; 1916.0bp to feature; MODIFIER silent_mutation Average:31.351; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N
vg0409860484 G -> A LOC_Os04g17930-LOC_Os04g17940 intergenic_region ; MODIFIER silent_mutation Average:31.351; most accessible tissue: Minghui63 flag leaf, score: 52.88 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409860484 NA 3.72E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409860484 9.98E-08 NA mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409860484 NA 1.31E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409860484 NA 3.08E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409860484 NA 2.71E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251