\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409804831:

Variant ID: vg0409804831 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9804831
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGCGTTCGTGGCAAAAACTCACTACGTGATTCGCGCGGTGAATTTTTGTCAATTAATGCCAATAGTGGCACACGTGGGTGCGAAGTTTTTCACCGGAAT[T/G]
CAAAAGTTCAAAAACTACCAAAACATGATTTTTGGACATACTGGAGTGTATTTTGCGCGTTCGTGGCAAAAACTCACTTCGTGACTCGCGCGCGAACTTT

Reverse complement sequence

AAAGTTCGCGCGCGAGTCACGAAGTGAGTTTTTGCCACGAACGCGCAAAATACACTCCAGTATGTCCAAAAATCATGTTTTGGTAGTTTTTGAACTTTTG[A/C]
ATTCCGGTGAAAAACTTCGCACCCACGTGTGCCACTATTGGCATTAATTGACAAAAATTCACCGCGCGAATCACGTAGTGAGTTTTTGCCACGAACGCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 0.20% 17.03% 24.44% NA
All Indica  2759 57.20% 0.30% 13.41% 29.10% NA
All Japonica  1512 62.10% 0.00% 21.03% 16.87% NA
Aus  269 62.80% 0.00% 14.50% 22.68% NA
Indica I  595 53.30% 0.20% 10.08% 36.47% NA
Indica II  465 51.80% 0.20% 17.63% 30.32% NA
Indica III  913 65.40% 0.50% 11.06% 23.00% NA
Indica Intermediate  786 53.70% 0.30% 16.16% 29.90% NA
Temperate Japonica  767 96.50% 0.00% 1.30% 2.22% NA
Tropical Japonica  504 6.70% 0.00% 53.57% 39.68% NA
Japonica Intermediate  241 68.50% 0.00% 15.77% 15.77% NA
VI/Aromatic  96 22.90% 0.00% 63.54% 13.54% NA
Intermediate  90 55.60% 0.00% 18.89% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409804831 T -> DEL N N silent_mutation Average:15.979; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0409804831 T -> G LOC_Os04g17850.1 downstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:15.979; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0409804831 T -> G LOC_Os04g17860.1 downstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:15.979; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0409804831 T -> G LOC_Os04g17850-LOC_Os04g17860 intergenic_region ; MODIFIER silent_mutation Average:15.979; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409804831 NA 5.44E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 9.99E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.83E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 4.12E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 2.16E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.73E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.92E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 5.67E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.93E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 2.14E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.20E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 2.06E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.43E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.85E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 7.75E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 4.21E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 9.24E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 1.48E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 1.91E-07 4.85E-35 mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409804831 NA 2.92E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251