\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409768258:

Variant ID: vg0409768258 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 9768258
Reference Allele: AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGTAlternative Allele: GAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT,A
Primary Allele: GAGTTGTGTCAAACACCTTG GTGAAATTTCGTTTGGTSecondary Allele: AAGTTGTGTCAAACACCTTG GTGAAATTTCGTTTGGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGTGGAGGGCCAGGCCGAACCCTCCTACCTACCGTACCCACCACCACCGTGACAGTCCGACTCCCTCCTCCCTCTCCAAATCACGTTATCTTAGTTCC[AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT/GAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT,A]
GTCGATTTCGAGATCTATTTGGAAAAACGGAACCGGCATAAATTCAGCATTCCATTTTTTATAATTTTTAATTTTGGTGTGGACTTTACAGTTGAGTCCC

Reverse complement sequence

GGGACTCAACTGTAAAGTCCACACCAAAATTAAAAATTATAAAAAATGGAATGCTGAATTTATGCCGGTTCCGTTTTTCCAAATAGATCTCGAAATCGAC[ACCAAACGAAATTTCACCAAGGTGTTTGACACAACTT/ACCAAACGAAATTTCACCAAGGTGTTTGACACAACTC,T]
GGAACTAAGATAACGTGATTTGGAGAGGGAGGAGGGAGTCGGACTGTCACGGTGGTGGTGGGTACGGTAGGTAGGAGGGTTCGGCCTGGCCCTCCACAAG

Allele Frequencies:

Populations Population SizeFrequency of GAGTTGTGTCAAACACCTTG GTGAAATTTCGTTTGGT(primary allele) Frequency of AAGTTGTGTCAAACACCTTG GTGAAATTTCGTTTGGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 25.30% 0.53% 0.28% NA
All Indica  2759 95.20% 4.70% 0.14% 0.00% NA
All Japonica  1512 29.20% 68.60% 1.32% 0.86% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 89.40% 10.30% 0.34% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.60% 0.13% 0.00% NA
Temperate Japonica  767 3.10% 96.30% 0.00% 0.52% NA
Tropical Japonica  504 69.40% 25.80% 3.17% 1.59% NA
Japonica Intermediate  241 28.20% 69.70% 1.66% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> A LOC_Os04g17820.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER N Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> A LOC_Os04g17810.1 downstream_gene_variant ; 673.0bp to feature; MODIFIER N Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> A LOC_Os04g17810-LOC_Os04g17820 intergenic_region ; MODIFIER N Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> DEL N N silent_mutation Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> GAGTTGTGTCAAACACCTTGGTGAAATTTC GTTTGGT LOC_Os04g17820.1 upstream_gene_variant ; 801.0bp to feature; MODIFIER silent_mutation Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> GAGTTGTGTCAAACACCTTGGTGAAATTTC GTTTGGT LOC_Os04g17810.1 downstream_gene_variant ; 672.0bp to feature; MODIFIER silent_mutation Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N
vg0409768258 AAGTTGTGTCAAACACCTTGGTGAAATTTCGTTTGGT -> GAGTTGTGTCAAACACCTTGGTGAAATTTC GTTTGGT LOC_Os04g17810-LOC_Os04g17820 intergenic_region ; MODIFIER silent_mutation Average:70.862; most accessible tissue: Minghui63 flag leaf, score: 95.773 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0409768258 AAGTT* A -0.01 0.07 0.05 0.0 -0.04 -0.04
vg0409768258 AAGTT* GAGTT* 0.0 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409768258 NA 3.29E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 5.36E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 5.79E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 3.27E-11 mr1194 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.41E-51 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 6.29E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 9.43E-07 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 6.68E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.52E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 3.00E-06 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 6.38E-46 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 9.15E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.03E-25 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.17E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.08E-29 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.32E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.23E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 3.34E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 5.25E-15 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 6.44E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 1.87E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409768258 NA 6.51E-73 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251