\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409745188:

Variant ID: vg0409745188 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9745188
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


ACGATCCTGCCATGGTTAGTAGCAAACAAGAAACACACACAATAATATGCACGCTCCTATCAACTACTAGGTAGTGGCAGCTCAAATATCACACACACTC[T/A]
AGCTTTTAACCAAGCTCTTACAAGTTCTTACCAAAGCAAGCGGAATGGTGACATACACCGACTCAACCAAGCACCCCAATGGAGGTTGGATGTATCGATG

Reverse complement sequence

CATCGATACATCCAACCTCCATTGGGGTGCTTGGTTGAGTCGGTGTATGTCACCATTCCGCTTGCTTTGGTAAGAACTTGTAAGAGCTTGGTTAAAAGCT[A/T]
GAGTGTGTGTGATATTTGAGCTGCCACTACCTAGTAGTTGATAGGAGCGTGCATATTATTGTGTGTGTTTCTTGTTTGCTACTAACCATGGCAGGATCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 34.50% 1.02% 2.75% NA
All Indica  2759 93.90% 4.70% 1.34% 0.04% NA
All Japonica  1512 0.90% 90.00% 0.60% 8.47% NA
Aus  269 97.80% 1.50% 0.37% 0.37% NA
Indica I  595 89.20% 8.40% 2.35% 0.00% NA
Indica II  465 93.30% 6.00% 0.65% 0.00% NA
Indica III  913 98.40% 1.10% 0.55% 0.00% NA
Indica Intermediate  786 92.60% 5.30% 1.91% 0.13% NA
Temperate Japonica  767 0.40% 94.50% 0.39% 4.69% NA
Tropical Japonica  504 1.20% 97.80% 0.00% 0.99% NA
Japonica Intermediate  241 2.10% 59.30% 2.49% 36.10% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409745188 T -> DEL N N silent_mutation Average:12.061; most accessible tissue: Callus, score: 39.277 N N N N
vg0409745188 T -> A LOC_Os04g17789.1 downstream_gene_variant ; 4246.0bp to feature; MODIFIER silent_mutation Average:12.061; most accessible tissue: Callus, score: 39.277 N N N N
vg0409745188 T -> A LOC_Os04g17780.1 intron_variant ; MODIFIER silent_mutation Average:12.061; most accessible tissue: Callus, score: 39.277 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409745188 NA 4.10E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 3.55E-06 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 2.64E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 4.49E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 5.86E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 3.13E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 1.75E-60 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 5.44E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 3.18E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 3.26E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 5.14E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 1.57E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409745188 NA 4.28E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251