\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409654099:

Variant ID: vg0409654099 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9654099
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTGCAGATGAATGATTAAGCTCACGAGTTGGGGTCTTACAAACCGATCTAGCGGCGAAACTGTTCTCGACAGATTAATCTAAGCAAAACCCGACTC[T/G]
AAACGATGACGGCTACTGAATAAATGTGATTAGGGACATCCTAGGGTTGCCCTAGGGCACACACCCCCTTGGGCTAAGCCCACGACACAATTACAAGGCC

Reverse complement sequence

GGCCTTGTAATTGTGTCGTGGGCTTAGCCCAAGGGGGTGTGTGCCCTAGGGCAACCCTAGGATGTCCCTAATCACATTTATTCAGTAGCCGTCATCGTTT[A/C]
GAGTCGGGTTTTGCTTAGATTAATCTGTCGAGAACAGTTTCGCCGCTAGATCGGTTTGTAAGACCCCAACTCGTGAGCTTAATCATTCATCTGCAATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 16.00% 8.36% 0.85% NA
All Indica  2759 57.00% 27.30% 14.21% 1.45% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 28.60% 42.00% 27.39% 2.02% NA
Indica II  465 76.10% 16.30% 6.88% 0.65% NA
Indica III  913 62.80% 24.40% 10.73% 2.08% NA
Indica Intermediate  786 60.60% 26.10% 12.60% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409654099 T -> DEL N N silent_mutation Average:32.774; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0409654099 T -> G LOC_Os04g17640.1 upstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:32.774; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0409654099 T -> G LOC_Os04g17630.1 downstream_gene_variant ; 3443.0bp to feature; MODIFIER silent_mutation Average:32.774; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0409654099 T -> G LOC_Os04g17630-LOC_Os04g17640 intergenic_region ; MODIFIER silent_mutation Average:32.774; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409654099 NA 5.20E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409654099 8.12E-06 NA mr1160_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409654099 NA 1.15E-12 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251