\
| Variant ID: vg0409571274 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9571274 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACTGTCCTTGCATTTTGGATTGATTCAAATTCAATTCATACTTTGGTCATTCGCAAATATAGTCTTCCCACGCCCAAAGAATGGATATTTATTATCAAT[A/T]
TATATTATATTGCTTTATTGGTCAGGCTGCCCATGACCACCTAAATCCACAGTATCTACATCAGAAAAGGAGACTTCAAATTTTTCATCATATGCTTTTT
AAAAAGCATATGATGAAAAATTTGAAGTCTCCTTTTCTGATGTAGATACTGTGGATTTAGGTGGTCATGGGCAGCCTGACCAATAAAGCAATATAATATA[T/A]
ATTGATAATAAATATCCATTCTTTGGGCGTGGGAAGACTATATTTGCGAATGACCAAAGTATGAATTGAATTTGAATCAATCCAAAATGCAAGGACAGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.50% | 0.50% | 38.36% | 39.70% | NA |
| All Indica | 2759 | 2.30% | 0.80% | 52.95% | 43.97% | NA |
| All Japonica | 1512 | 61.20% | 0.00% | 4.17% | 34.66% | NA |
| Aus | 269 | 0.70% | 0.40% | 89.59% | 9.29% | NA |
| Indica I | 595 | 4.40% | 0.30% | 36.30% | 58.99% | NA |
| Indica II | 465 | 2.20% | 1.30% | 53.33% | 43.23% | NA |
| Indica III | 913 | 0.40% | 1.00% | 64.95% | 33.63% | NA |
| Indica Intermediate | 786 | 2.90% | 0.60% | 51.40% | 45.04% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.52% | 3.52% | NA |
| Tropical Japonica | 504 | 4.60% | 0.00% | 10.71% | 84.72% | NA |
| Japonica Intermediate | 241 | 68.90% | 0.00% | 2.07% | 29.05% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 13.54% | 85.42% | NA |
| Intermediate | 90 | 25.60% | 0.00% | 38.89% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409571274 | A -> DEL | N | N | silent_mutation | Average:9.144; most accessible tissue: Callus, score: 21.496 | N | N | N | N |
| vg0409571274 | A -> T | LOC_Os04g17490.1 | upstream_gene_variant ; 2826.0bp to feature; MODIFIER | silent_mutation | Average:9.144; most accessible tissue: Callus, score: 21.496 | N | N | N | N |
| vg0409571274 | A -> T | LOC_Os04g17500.1 | downstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:9.144; most accessible tissue: Callus, score: 21.496 | N | N | N | N |
| vg0409571274 | A -> T | LOC_Os04g17490-LOC_Os04g17500 | intergenic_region ; MODIFIER | silent_mutation | Average:9.144; most accessible tissue: Callus, score: 21.496 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409571274 | NA | 1.96E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.39E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.44E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 5.38E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 9.65E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 7.61E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 9.90E-06 | mr1220 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.23E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.12E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 6.14E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 8.35E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 6.16E-06 | mr1378 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 4.04E-09 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.83E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | 3.38E-06 | NA | mr1499 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 4.11E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.28E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.77E-11 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 4.60E-08 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 8.11E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 3.35E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 3.14E-29 | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 5.12E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.19E-14 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 2.58E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.45E-07 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.50E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 2.33E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 6.31E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 2.49E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409571274 | NA | 1.74E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |