\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409571274:

Variant ID: vg0409571274 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9571274
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTGTCCTTGCATTTTGGATTGATTCAAATTCAATTCATACTTTGGTCATTCGCAAATATAGTCTTCCCACGCCCAAAGAATGGATATTTATTATCAAT[A/T]
TATATTATATTGCTTTATTGGTCAGGCTGCCCATGACCACCTAAATCCACAGTATCTACATCAGAAAAGGAGACTTCAAATTTTTCATCATATGCTTTTT

Reverse complement sequence

AAAAAGCATATGATGAAAAATTTGAAGTCTCCTTTTCTGATGTAGATACTGTGGATTTAGGTGGTCATGGGCAGCCTGACCAATAAAGCAATATAATATA[T/A]
ATTGATAATAAATATCCATTCTTTGGGCGTGGGAAGACTATATTTGCGAATGACCAAAGTATGAATTGAATTTGAATCAATCCAAAATGCAAGGACAGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.50% 0.50% 38.36% 39.70% NA
All Indica  2759 2.30% 0.80% 52.95% 43.97% NA
All Japonica  1512 61.20% 0.00% 4.17% 34.66% NA
Aus  269 0.70% 0.40% 89.59% 9.29% NA
Indica I  595 4.40% 0.30% 36.30% 58.99% NA
Indica II  465 2.20% 1.30% 53.33% 43.23% NA
Indica III  913 0.40% 1.00% 64.95% 33.63% NA
Indica Intermediate  786 2.90% 0.60% 51.40% 45.04% NA
Temperate Japonica  767 96.00% 0.00% 0.52% 3.52% NA
Tropical Japonica  504 4.60% 0.00% 10.71% 84.72% NA
Japonica Intermediate  241 68.90% 0.00% 2.07% 29.05% NA
VI/Aromatic  96 1.00% 0.00% 13.54% 85.42% NA
Intermediate  90 25.60% 0.00% 38.89% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409571274 A -> DEL N N silent_mutation Average:9.144; most accessible tissue: Callus, score: 21.496 N N N N
vg0409571274 A -> T LOC_Os04g17490.1 upstream_gene_variant ; 2826.0bp to feature; MODIFIER silent_mutation Average:9.144; most accessible tissue: Callus, score: 21.496 N N N N
vg0409571274 A -> T LOC_Os04g17500.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:9.144; most accessible tissue: Callus, score: 21.496 N N N N
vg0409571274 A -> T LOC_Os04g17490-LOC_Os04g17500 intergenic_region ; MODIFIER silent_mutation Average:9.144; most accessible tissue: Callus, score: 21.496 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409571274 NA 1.96E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.39E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.44E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 5.38E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 9.65E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 7.61E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 9.90E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.23E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.12E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 6.14E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 8.35E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 6.16E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 4.04E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.83E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 3.38E-06 NA mr1499 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 4.11E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.28E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.77E-11 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 4.60E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 8.11E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 3.35E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 3.14E-29 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 5.12E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.19E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 2.58E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.45E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.50E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 2.33E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 6.31E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 2.49E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409571274 NA 1.74E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251