Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409507807:

Variant ID: vg0409507807 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9507807
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGACGAGCACTTAATGGGAAGTACTTGAAGAAATATTACCCAAGTGTTTGGATCAGTTCATGATCAACTAAGTGTTGCCGATACATGCTAGCCGATGT[G/A]
TTGACATCGCCTTTAGATGGCCAATATAAGTTATATCGCCCTTAGCATTTTAAAACTTATCATAATCGGCTGTGCTCTGCCGATGTATGATGGCCGATAT

Reverse complement sequence

ATATCGGCCATCATACATCGGCAGAGCACAGCCGATTATGATAAGTTTTAAAATGCTAAGGGCGATATAACTTATATTGGCCATCTAAAGGCGATGTCAA[C/T]
ACATCGGCTAGCATGTATCGGCAACACTTAGTTGATCATGAACTGATCCAAACACTTGGGTAATATTTCTTCAAGTACTTCCCATTAAGTGCTCGTCCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	24.90%	0.15%	9.75%	NA
All Indica	2759	98.20%	1.70%	0.18%	0.00%	NA
All Japonica	1512	2.20%	71.70%	0.00%	26.06%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	0.70%	0.34%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.70%	0.38%	0.00%	NA
Temperate Japonica	767	0.50%	97.90%	0.00%	1.56%	NA
Tropical Japonica	504	3.80%	28.40%	0.00%	67.86%	NA
Japonica Intermediate	241	4.60%	78.80%	0.00%	16.60%	NA
VI/Aromatic	96	21.90%	12.50%	1.04%	64.58%	NA
Intermediate	90	55.60%	37.80%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409507807	G -> DEL	N	N	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N
vg0409507807	G -> A	LOC_Os04g17370.1	upstream_gene_variant ; 3684.0bp to feature; MODIFIER	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N
vg0409507807	G -> A	LOC_Os04g17340.1	downstream_gene_variant ; 3164.0bp to feature; MODIFIER	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N
vg0409507807	G -> A	LOC_Os04g17350.1	downstream_gene_variant ; 690.0bp to feature; MODIFIER	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N
vg0409507807	G -> A	LOC_Os04g17360.1	downstream_gene_variant ; 582.0bp to feature; MODIFIER	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N
vg0409507807	G -> A	LOC_Os04g17350-LOC_Os04g17360	intergenic_region ; MODIFIER	silent_mutation	Average:44.771; most accessible tissue: Callus, score: 67.31	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409507807	NA	3.88E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	3.51E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.33E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.81E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	3.35E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	1.56E-41	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	8.85E-42	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	3.99E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.37E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	7.14E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	8.34E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	7.22E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	5.83E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	6.58E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	7.82E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	7.02E-07	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	1.51E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	8.94E-27	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	7.73E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	9.03E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.36E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	1.27E-06	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	1.25E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.41E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	5.68E-07	1.01E-11	mr1746	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	5.56E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	3.01E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	4.16E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	3.62E-30	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.64E-14	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	5.05E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	4.23E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	2.22E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	9.65E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	NA	4.88E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807	3.33E-06	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251