\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409507807:

Variant ID: vg0409507807 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9507807
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, G: 0.44, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGACGAGCACTTAATGGGAAGTACTTGAAGAAATATTACCCAAGTGTTTGGATCAGTTCATGATCAACTAAGTGTTGCCGATACATGCTAGCCGATGT[G/A]
TTGACATCGCCTTTAGATGGCCAATATAAGTTATATCGCCCTTAGCATTTTAAAACTTATCATAATCGGCTGTGCTCTGCCGATGTATGATGGCCGATAT

Reverse complement sequence

ATATCGGCCATCATACATCGGCAGAGCACAGCCGATTATGATAAGTTTTAAAATGCTAAGGGCGATATAACTTATATTGGCCATCTAAAGGCGATGTCAA[C/T]
ACATCGGCTAGCATGTATCGGCAACACTTAGTTGATCATGAACTGATCCAAACACTTGGGTAATATTTCTTCAAGTACTTCCCATTAAGTGCTCGTCCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 24.90% 0.15% 9.75% NA
All Indica  2759 98.20% 1.70% 0.18% 0.00% NA
All Japonica  1512 2.20% 71.70% 0.00% 26.06% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.34% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.70% 0.38% 0.00% NA
Temperate Japonica  767 0.50% 97.90% 0.00% 1.56% NA
Tropical Japonica  504 3.80% 28.40% 0.00% 67.86% NA
Japonica Intermediate  241 4.60% 78.80% 0.00% 16.60% NA
VI/Aromatic  96 21.90% 12.50% 1.04% 64.58% NA
Intermediate  90 55.60% 37.80% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409507807 G -> DEL N N silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N
vg0409507807 G -> A LOC_Os04g17370.1 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N
vg0409507807 G -> A LOC_Os04g17340.1 downstream_gene_variant ; 3164.0bp to feature; MODIFIER silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N
vg0409507807 G -> A LOC_Os04g17350.1 downstream_gene_variant ; 690.0bp to feature; MODIFIER silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N
vg0409507807 G -> A LOC_Os04g17360.1 downstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N
vg0409507807 G -> A LOC_Os04g17350-LOC_Os04g17360 intergenic_region ; MODIFIER silent_mutation Average:44.771; most accessible tissue: Callus, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409507807 NA 3.88E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 3.51E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.33E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.81E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 3.35E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 1.56E-41 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 8.85E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 3.99E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.37E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 7.14E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 8.34E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 7.22E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 5.83E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 6.58E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 7.82E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 7.02E-07 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 1.51E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 8.94E-27 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 7.73E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 9.03E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.36E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 1.27E-06 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 1.25E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.41E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 5.68E-07 1.01E-11 mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 5.56E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 3.01E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 4.16E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 3.62E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.64E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 5.05E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 4.23E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 2.22E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 9.65E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 NA 4.88E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409507807 3.33E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251