\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409495729:

Variant ID: vg0409495729 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9495729
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CTATCCGATATAAGGTCGGACTATCCGATACGTCAGACTATCTGAAATTTCTCAGAACTTCACTCTCTGTTTTGAATTGCTTTTTATTCCTTTTGAAATT[T/C]
TTGGTTCAAAAATAACGGAATATCCGATATGACATCGGACTATCCGATCGATCGGATTGTCCGAAATTCTCCAGAATTTCGTTCTCTGTCTCTGGCCTGC

Reverse complement sequence

GCAGGCCAGAGACAGAGAACGAAATTCTGGAGAATTTCGGACAATCCGATCGATCGGATAGTCCGATGTCATATCGGATATTCCGTTATTTTTGAACCAA[A/G]
AATTTCAAAAGGAATAAAAAGCAATTCAAAACAGAGAGTGAAGTTCTGAGAAATTTCAGATAGTCTGACGTATCGGATAGTCCGACCTTATATCGGATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 23.40% 16.61% 21.31% NA
All Indica  2759 53.50% 0.90% 27.44% 18.09% NA
All Japonica  1512 1.60% 68.80% 0.99% 28.64% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 24.70% 0.80% 29.08% 45.38% NA
Indica II  465 73.50% 1.90% 15.27% 9.25% NA
Indica III  913 59.50% 0.20% 32.53% 7.78% NA
Indica Intermediate  786 56.60% 1.30% 27.48% 14.63% NA
Temperate Japonica  767 0.50% 97.70% 0.13% 1.69% NA
Tropical Japonica  504 2.20% 22.00% 2.58% 73.21% NA
Japonica Intermediate  241 3.70% 74.70% 0.41% 21.16% NA
VI/Aromatic  96 22.90% 9.40% 3.12% 64.58% NA
Intermediate  90 42.20% 32.20% 11.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409495729 T -> C LOC_Os04g17320.1 downstream_gene_variant ; 805.0bp to feature; MODIFIER silent_mutation Average:19.774; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0409495729 T -> C LOC_Os04g17330.1 downstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:19.774; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0409495729 T -> C LOC_Os04g17320-LOC_Os04g17330 intergenic_region ; MODIFIER silent_mutation Average:19.774; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N
vg0409495729 T -> DEL N N silent_mutation Average:19.774; most accessible tissue: Minghui63 flag leaf, score: 33.603 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409495729 NA 5.63E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 8.49E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.30E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 5.03E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 8.30E-21 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 4.95E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 5.80E-61 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 7.20E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 2.76E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 9.27E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 2.11E-34 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 5.95E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 8.98E-71 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.21E-62 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 4.07E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 4.80E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 2.56E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.83E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.57E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 6.07E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.18E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.30E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.03E-43 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 8.34E-78 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 2.45E-07 1.31E-34 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.09E-13 mr1789 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.12E-06 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 4.75E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 3.51E-73 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.45E-70 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.31E-78 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 9.91E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 2.61E-54 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.03E-79 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.12E-80 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409495729 NA 1.99E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251