\
| Variant ID: vg0409481337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9481337 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.12, others allele: 0.00, population size: 209. )
TGCTTCTCCAAATCGGCCCAACTGTTGATTGATCCACATGGCAAAGAAGAACACCAAGTAAAAGCCGATCCAGACAAAGACAATGGAAACAACCTAACCC[T/G]
CAGAGCATCCACAGCCGATGCTTCACCACACTGAGCTAAGAATCGGCTAACGTGCTCATAGGTTGAAACGCTGTCCTGTCCTGAGAATTTTGAAAAATAT
ATATTTTTCAAAATTCTCAGGACAGGACAGCGTTTCAACCTATGAGCACGTTAGCCGATTCTTAGCTCAGTGTGGTGAAGCATCGGCTGTGGATGCTCTG[A/C]
GGGTTAGGTTGTTTCCATTGTCTTTGTCTGGATCGGCTTTTACTTGGTGTTCTTCTTTGCCATGTGGATCAATCAACAGTTGGGCCGATTTGGAGAAGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 31.00% | 2.24% | 4.08% | NA |
| All Indica | 2759 | 94.10% | 1.30% | 1.05% | 3.62% | NA |
| All Japonica | 1512 | 2.40% | 87.20% | 4.96% | 5.42% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 92.60% | 0.70% | 1.51% | 5.21% | NA |
| Indica II | 465 | 94.60% | 2.40% | 0.65% | 2.37% | NA |
| Indica III | 913 | 94.70% | 1.00% | 0.66% | 3.61% | NA |
| Indica Intermediate | 786 | 94.00% | 1.40% | 1.40% | 3.18% | NA |
| Temperate Japonica | 767 | 0.50% | 97.70% | 0.52% | 1.30% | NA |
| Tropical Japonica | 504 | 4.00% | 71.80% | 12.30% | 11.90% | NA |
| Japonica Intermediate | 241 | 5.00% | 86.30% | 3.73% | 4.98% | NA |
| VI/Aromatic | 96 | 17.70% | 74.00% | 1.04% | 7.29% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409481337 | T -> DEL | LOC_Os04g17290.1 | N | frameshift_variant | Average:50.911; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0409481337 | T -> G | LOC_Os04g17290.1 | synonymous_variant ; p.Arg91Arg; LOW | synonymous_codon | Average:50.911; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409481337 | NA | 9.72E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 6.19E-59 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 2.58E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.40E-68 | mr1132 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 9.78E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.65E-33 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.91E-38 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 3.33E-77 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.10E-33 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.06E-58 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 3.60E-74 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.00E-12 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 7.46E-80 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 2.48E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 4.87E-99 | mr1619_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.04E-35 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 1.09E-74 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | 2.28E-06 | NA | mr1870_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409481337 | NA | 7.01E-121 | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |