\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409475911:

Variant ID: vg0409475911 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9475911
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGGCTTTGCATCTTCTCGGAGGTTGCTGGTGTGGTCTAACCCCTGGTTTGATAGGTAGCCGATGTTCAACAATCGATCGGCTGAGTCCTGGCATCTTA[T/A]
AATACTCCCAAGCAAAGCAATCTTTGAATTCCTTTAAGAGCTCTGTCAACTTGGTTCTAAATTCTGGAGATAAGTTCTTACTGATAAATGTCGGCCTTGG

Reverse complement sequence

CCAAGGCCGACATTTATCAGTAAGAACTTATCTCCAGAATTTAGAACCAAGTTGACAGAGCTCTTAAAGGAATTCAAAGATTGCTTTGCTTGGGAGTATT[A/T]
TAAGATGCCAGGACTCAGCCGATCGATTGTTGAACATCGGCTACCTATCAAACCAGGGGTTAGACCACACCAGCAACCTCCGAGAAGATGCAAAGCCGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 26.20% 1.61% 3.75% NA
All Indica  2759 55.00% 44.20% 0.62% 0.14% NA
All Japonica  1512 85.30% 0.30% 3.57% 10.91% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 23.50% 75.50% 1.01% 0.00% NA
Indica II  465 75.50% 23.40% 0.65% 0.43% NA
Indica III  913 62.20% 37.20% 0.44% 0.11% NA
Indica Intermediate  786 58.40% 41.00% 0.51% 0.13% NA
Temperate Japonica  767 97.50% 0.00% 0.65% 1.83% NA
Tropical Japonica  504 65.90% 0.40% 7.94% 25.79% NA
Japonica Intermediate  241 86.70% 0.80% 3.73% 8.71% NA
VI/Aromatic  96 94.80% 1.00% 2.08% 2.08% NA
Intermediate  90 77.80% 12.20% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409475911 T -> DEL LOC_Os04g17280.1 N frameshift_variant Average:49.576; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0409475911 T -> A LOC_Os04g17280.1 missense_variant ; p.Tyr271Phe; MODERATE nonsynonymous_codon ; Y271F Average:49.576; most accessible tissue: Minghui63 flag leaf, score: 76.091 benign 0.678 TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409475911 NA 4.74E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 NA 1.57E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 NA 6.11E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 NA 9.70E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 5.63E-07 NA mr1830 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 1.01E-06 4.22E-10 mr1830 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 1.54E-07 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 3.04E-07 4.72E-12 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 NA 6.56E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 NA 1.84E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 3.24E-11 5.16E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409475911 1.35E-09 3.89E-26 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251