| Variant ID: vg0409425501 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9425501 |
| Reference Allele: T | Alternative Allele: A,G |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 309. )
GACCCTTGGATTTCTATCATCAAAGAGGAACAAAAACTAACTAATGTTAAGCTATTACTTGGTGTATTAACTTTCATGGGAGTACTAAGTTACACTTTTC[T/A,G]
TAACCCGTGTACCCAAACAAATCTCTTGGATATAAATGAATGCGTAGCACCAGAATCGAATAAAACTGTAGAAGGAATTGAGTTCACAGGGAACGTACCC
GGGTACGTTCCCTGTGAACTCAATTCCTTCTACAGTTTTATTCGATTCTGGTGCTACGCATTCATTTATATCCAAGAGATTTGTTTGGGTACACGGGTTA[A/T,C]
GAAAAGTGTAACTTAGTACTCCCATGAAAGTTAATACACCAAGTAATAGCTTAACATTAGTTAGTTTTTGTTCCTCTTTGATGATAGAAATCCAAGGGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 2.50% | 1.16% | 13.92% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.04% | 0.36% | NA |
| All Japonica | 1512 | 52.10% | 7.80% | 3.31% | 36.84% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 99.50% | 0.00% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 76.90% | 13.70% | 5.74% | 3.65% | NA |
| Tropical Japonica | 504 | 6.70% | 1.60% | 0.00% | 91.67% | NA |
| Japonica Intermediate | 241 | 67.60% | 2.10% | 2.49% | 27.80% | NA |
| VI/Aromatic | 96 | 22.90% | 0.00% | 1.04% | 76.04% | NA |
| Intermediate | 90 | 75.60% | 1.10% | 3.33% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409425501 | T -> G | LOC_Os04g17170.1 | upstream_gene_variant ; 1129.0bp to feature; MODIFIER | N | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> G | LOC_Os04g17190.1 | upstream_gene_variant ; 3451.0bp to feature; MODIFIER | N | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> G | LOC_Os04g17160.1 | downstream_gene_variant ; 4906.0bp to feature; MODIFIER | N | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> G | LOC_Os04g17180.1 | intron_variant ; MODIFIER | N | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> DEL | N | N | silent_mutation | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> A | LOC_Os04g17170.1 | upstream_gene_variant ; 1129.0bp to feature; MODIFIER | silent_mutation | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> A | LOC_Os04g17190.1 | upstream_gene_variant ; 3451.0bp to feature; MODIFIER | silent_mutation | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> A | LOC_Os04g17160.1 | downstream_gene_variant ; 4906.0bp to feature; MODIFIER | silent_mutation | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| vg0409425501 | T -> A | LOC_Os04g17180.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.281; most accessible tissue: Callus, score: 56.207 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409425501 | 2.09E-07 | NA | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | NA | 6.14E-08 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 4.35E-09 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 9.23E-06 | 2.93E-11 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 1.63E-06 | 2.22E-08 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 1.42E-06 | 1.42E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 2.13E-06 | NA | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | NA | 8.59E-07 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 1.23E-07 | NA | mr1035_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | NA | 9.14E-07 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 2.49E-06 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | NA | 5.50E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 5.87E-06 | 5.86E-06 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | 1.69E-09 | NA | mr1631_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409425501 | NA | 6.28E-10 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |