\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409318595:

Variant ID: vg0409318595 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9318595
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTATCACTCAATTTCCTTCGCGAACACCGACGCTTGCACGCACACCTCGTGAAGCCCGTTGCGATTTGCGAAGATCTCTCCCACACGGTGTCCATCCA[C/T]
CATGCGCCATCTCGTATCCAACTTCGTCACCCGGCATCCTTGACCGTCTGGACCTCAACTCCTCCCCGAGTTTAGTCCCGATCCTCACCGTTGACCGAAG

Reverse complement sequence

CTTCGGTCAACGGTGAGGATCGGGACTAAACTCGGGGAGGAGTTGAGGTCCAGACGGTCAAGGATGCCGGGTGACGAAGTTGGATACGAGATGGCGCATG[G/A]
TGGATGGACACCGTGTGGGAGAGATCTTCGCAAATCGCAACGGGCTTCACGAGGTGTGCGTGCAAGCGTCGGTGTTCGCGAAGGAAATTGAGTGATAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 14.50% 0.11% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 62.00% 37.80% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 94.00% 0.40% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 82.30% 1.04% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409318595 C -> T LOC_Os04g17020.1 upstream_gene_variant ; 1226.0bp to feature; MODIFIER silent_mutation Average:55.191; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0409318595 C -> T LOC_Os04g17010-LOC_Os04g17020 intergenic_region ; MODIFIER silent_mutation Average:55.191; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409318595 NA 6.79E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 5.19E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 4.58E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 6.80E-06 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 3.59E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 4.93E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 2.45E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 8.35E-06 mr1887 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 1.70E-06 mr1887 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 5.90E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409318595 NA 7.63E-07 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251