\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409265113:

Variant ID: vg0409265113 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 9265113
Reference Allele: AAlternative Allele: AG,G,AGAG,AGAGAG
Primary Allele: AGSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGCAACATAAAGGGAAATTCAATTTCTTCAGTTCCATGGCATGGGACAAATTTCTGAGTGTGAAAATCAAACAAATCAATTAGTGTTGAGAGAGAGA[A/AG,G,AGAG,AGAGAG]
AGAGAGAGAGTACTGCATCCAGGAGTTGGGGCCGCGTCGCCGCAGCCTGGAGACAAAGGCGGGGTACGGAGTGAGGGCAGGGACGGCGGTGGCGCGGTTC

Reverse complement sequence

GAACCGCGCCACCGCCGTCCCTGCCCTCACTCCGTACCCCGCCTTTGTCTCCAGGCTGCGGCGACGCGGCCCCAACTCCTGGATGCAGTACTCTCTCTCT[T/CT,C,CTCT,CTCTCT]
TCTCTCTCTCAACACTAATTGATTTGTTTGATTTTCACACTCAGAAATTTGTCCCATGCCATGGAACTGAAGAAATTGAATTTCCCTTTATGTTGCTTTT

Allele Frequencies:

Populations Population SizeFrequency of AG(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 28.00% 1.33% 11.51% A: 22.58%; AGAG: 0.15%; AGAGAG: 0.02%
All Indica  2759 50.70% 47.00% 0.87% 0.58% A: 0.65%; AGAG: 0.18%
All Japonica  1512 1.10% 0.80% 1.79% 28.97% A: 67.39%
Aus  269 96.30% 1.50% 1.49% 0.00% AGAG: 0.74%
Indica I  595 22.20% 76.60% 0.67% 0.34% A: 0.17%
Indica II  465 69.90% 26.50% 1.51% 0.86% A: 1.29%
Indica III  913 57.40% 41.00% 0.33% 0.44% AGAG: 0.55%; A: 0.33%
Indica Intermediate  786 53.30% 43.60% 1.27% 0.76% A: 1.02%
Temperate Japonica  767 0.80% 0.00% 0.26% 2.48% A: 96.48%
Tropical Japonica  504 1.00% 2.20% 4.56% 71.23% A: 21.03%
Japonica Intermediate  241 2.10% 0.40% 0.83% 24.90% A: 71.78%
VI/Aromatic  96 13.50% 0.00% 3.12% 75.00% A: 7.29%; AGAGAG: 1.04%
Intermediate  90 35.60% 13.30% 5.56% 20.00% A: 25.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409265113 A -> AGAGAG LOC_Os04g16940.1 intron_variant ; MODIFIER silent_mutation Average:86.236; most accessible tissue: Zhenshan97 flag leaf, score: 93.368 N N N N
vg0409265113 A -> G LOC_Os04g16940.1 intron_variant ; MODIFIER silent_mutation Average:86.236; most accessible tissue: Zhenshan97 flag leaf, score: 93.368 N N N N
vg0409265113 A -> DEL N N silent_mutation Average:86.236; most accessible tissue: Zhenshan97 flag leaf, score: 93.368 N N N N
vg0409265113 A -> AGAG LOC_Os04g16940.1 intron_variant ; MODIFIER silent_mutation Average:86.236; most accessible tissue: Zhenshan97 flag leaf, score: 93.368 N N N N
vg0409265113 A -> AG LOC_Os04g16940.1 intron_variant ; MODIFIER silent_mutation Average:86.236; most accessible tissue: Zhenshan97 flag leaf, score: 93.368 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0409265113 A AG 0.02 0.01 -0.02 0.02 0.0 -0.03
vg0409265113 A AGAG 0.01 0.03 -0.03 0.03 -0.01 -0.06
vg0409265113 A AGAGA* 0.34 0.28 0.17 0.22 0.19 0.18
vg0409265113 A G 0.07 0.05 0.05 0.07 0.07 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409265113 NA 1.15E-14 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 6.54E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 3.01E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 2.45E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 2.68E-06 NA mr1723 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 3.35E-06 2.84E-06 mr1759 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 1.56E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 3.82E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 1.13E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 9.82E-07 NA mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 1.87E-08 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 1.06E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 4.52E-06 NA mr1988 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 3.08E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 5.17E-06 NA mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409265113 NA 8.41E-12 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251