\
| Variant ID: vg0409247981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9247981 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTCACACACATGTAAGTGTTTGGAATTTTGGATGGAAATTCCGGGCGTGA[A/C]
AAGTTGGTATCAGAGCCCCTTTGACCCTAGGTTATGCCAAATGGTTACCCATAGAAGCCCTCTAAAAATATTGGAAAAGTAGAACTGTTCTCCTCTCCTT
AAGGAGAGGAGAACAGTTCTACTTTTCCAATATTTTTAGAGGGCTTCTATGGGTAACCATTTGGCATAACCTAGGGTCAAAGGGGCTCTGATACCAACTT[T/G]
TCACGCCCGGAATTTCCATCCAAAATTCCAAACACTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.20% | 0.20% | 31.63% | 47.02% | NA |
| All Indica | 2759 | 2.00% | 0.30% | 45.99% | 51.76% | NA |
| All Japonica | 1512 | 61.00% | 0.10% | 0.46% | 38.36% | NA |
| Aus | 269 | 0.40% | 0.00% | 66.54% | 33.09% | NA |
| Indica I | 595 | 0.70% | 0.00% | 27.06% | 72.27% | NA |
| Indica II | 465 | 2.20% | 0.00% | 30.75% | 67.10% | NA |
| Indica III | 913 | 1.60% | 0.50% | 69.33% | 28.48% | NA |
| Indica Intermediate | 786 | 3.30% | 0.30% | 42.24% | 54.20% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.00% | 4.04% | NA |
| Tropical Japonica | 504 | 4.20% | 0.00% | 1.39% | 94.44% | NA |
| Japonica Intermediate | 241 | 68.90% | 0.80% | 0.00% | 30.29% | NA |
| VI/Aromatic | 96 | 2.10% | 0.00% | 16.67% | 81.25% | NA |
| Intermediate | 90 | 21.10% | 0.00% | 26.67% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409247981 | A -> C | LOC_Os04g16900.1 | downstream_gene_variant ; 3243.0bp to feature; MODIFIER | silent_mutation | Average:7.471; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0409247981 | A -> C | LOC_Os04g16910.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.471; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0409247981 | A -> DEL | N | N | silent_mutation | Average:7.471; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409247981 | NA | 1.14E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 4.00E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 9.54E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | 2.62E-06 | 2.63E-36 | mr1789 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 1.30E-39 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 2.51E-12 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 1.38E-07 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409247981 | NA | 2.02E-28 | mr1789_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |