\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409232620:

Variant ID: vg0409232620 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9232620
Reference Allele: TAlternative Allele: A,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CGGAGTGAAAATGGTTAGACCCTCAACACTCGACATAATGAGATCTCTCTAAAGGCAACATCAGTGGTACCCCAATGAAAAGAGGGATGGAATATTTGAA[T/A,G]
GTGACATCATATAGAGACTCTTGGGAACTCCCTAACCTTGGAAGCTGTTACAGGATGGTAAGCGGCAATTACACCCTAGTGGTGTGATTATGAAACAAGA

Reverse complement sequence

TCTTGTTTCATAATCACACCACTAGGGTGTAATTGCCGCTTACCATCCTGTAACAGCTTCCAAGGTTAGGGAGTTCCCAAGAGTCTCTATATGATGTCAC[A/T,C]
TTCAAATATTCCATCCCTCTTTTCATTGGGGTACCACTGATGTTGCCTTTAGAGAGATCTCATTATGTCGAGTGTTGAGGGTCTAACCATTTTCACTCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.50% 12.80% 2.01% 11.02% G: 0.74%
All Indica  2759 98.30% 0.50% 0.54% 0.04% G: 0.58%
All Japonica  1512 24.90% 38.20% 2.98% 33.93% NA
Aus  269 86.60% 0.00% 6.32% 0.00% G: 7.06%
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.70% 0.90% 0.22% 0.22% NA
Indica III  913 96.90% 0.20% 1.20% 0.00% G: 1.64%
Indica Intermediate  786 98.70% 0.90% 0.25% 0.00% G: 0.13%
Temperate Japonica  767 26.60% 68.70% 1.43% 3.26% NA
Tropical Japonica  504 8.10% 1.40% 4.56% 85.91% NA
Japonica Intermediate  241 54.40% 18.30% 4.56% 22.82% NA
VI/Aromatic  96 84.40% 0.00% 12.50% 3.12% NA
Intermediate  90 76.70% 12.20% 6.67% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409232620 T -> G LOC_Os04g16850.1 upstream_gene_variant ; 4955.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> G LOC_Os04g16860.1 downstream_gene_variant ; 462.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> G LOC_Os04g16870.1 downstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> G LOC_Os04g16880.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> G LOC_Os04g16860-LOC_Os04g16870 intergenic_region ; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> DEL N N silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> A LOC_Os04g16850.1 upstream_gene_variant ; 4955.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> A LOC_Os04g16860.1 downstream_gene_variant ; 462.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> A LOC_Os04g16870.1 downstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> A LOC_Os04g16880.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N
vg0409232620 T -> A LOC_Os04g16860-LOC_Os04g16870 intergenic_region ; MODIFIER silent_mutation Average:14.282; most accessible tissue: Callus, score: 31.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409232620 NA 6.51E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0409232620 NA 3.59E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0409232620 NA 1.24E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.03E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.62E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.84E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 2.68E-06 1.27E-15 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.02E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 3.23E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.61E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.61E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.26E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.13E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 9.47E-14 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 3.65E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 8.90E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.51E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.52E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.18E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.09E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.39E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.96E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.92E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.12E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.33E-13 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 8.59E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.67E-16 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 3.78E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 2.09E-07 7.40E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.82E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 9.13E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.19E-16 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.42E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.90E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.51E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.20E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 9.35E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 6.43E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 4.25E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.51E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 7.47E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.74E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 8.99E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 6.32E-08 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 7.62E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.96E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 6.51E-06 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 2.38E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 5.21E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.37E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620 NA 1.03E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251