Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409232620:

Variant ID: vg0409232620 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9232620
Reference Allele: T	Alternative Allele: A,G
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGGAGTGAAAATGGTTAGACCCTCAACACTCGACATAATGAGATCTCTCTAAAGGCAACATCAGTGGTACCCCAATGAAAAGAGGGATGGAATATTTGAA[T/A,G]
GTGACATCATATAGAGACTCTTGGGAACTCCCTAACCTTGGAAGCTGTTACAGGATGGTAAGCGGCAATTACACCCTAGTGGTGTGATTATGAAACAAGA

Reverse complement sequence

TCTTGTTTCATAATCACACCACTAGGGTGTAATTGCCGCTTACCATCCTGTAACAGCTTCCAAGGTTAGGGAGTTCCCAAGAGTCTCTATATGATGTCAC[A/T,C]
TTCAAATATTCCATCCCTCTTTTCATTGGGGTACCACTGATGTTGCCTTTAGAGAGATCTCATTATGTCGAGTGTTGAGGGTCTAACCATTTTCACTCCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	12.80%	2.01%	11.02%	G: 0.74%
All Indica	2759	98.30%	0.50%	0.54%	0.04%	G: 0.58%
All Japonica	1512	24.90%	38.20%	2.98%	33.93%	NA
Aus	269	86.60%	0.00%	6.32%	0.00%	G: 7.06%
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	98.70%	0.90%	0.22%	0.22%	NA
Indica III	913	96.90%	0.20%	1.20%	0.00%	G: 1.64%
Indica Intermediate	786	98.70%	0.90%	0.25%	0.00%	G: 0.13%
Temperate Japonica	767	26.60%	68.70%	1.43%	3.26%	NA
Tropical Japonica	504	8.10%	1.40%	4.56%	85.91%	NA
Japonica Intermediate	241	54.40%	18.30%	4.56%	22.82%	NA
VI/Aromatic	96	84.40%	0.00%	12.50%	3.12%	NA
Intermediate	90	76.70%	12.20%	6.67%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409232620	T -> G	LOC_Os04g16850.1	upstream_gene_variant ; 4955.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> G	LOC_Os04g16860.1	downstream_gene_variant ; 462.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> G	LOC_Os04g16870.1	downstream_gene_variant ; 1455.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> G	LOC_Os04g16880.1	downstream_gene_variant ; 4521.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> G	LOC_Os04g16860-LOC_Os04g16870	intergenic_region ; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> DEL	N	N	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> A	LOC_Os04g16850.1	upstream_gene_variant ; 4955.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> A	LOC_Os04g16860.1	downstream_gene_variant ; 462.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> A	LOC_Os04g16870.1	downstream_gene_variant ; 1455.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> A	LOC_Os04g16880.1	downstream_gene_variant ; 4521.0bp to feature; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N
vg0409232620	T -> A	LOC_Os04g16860-LOC_Os04g16870	intergenic_region ; MODIFIER	silent_mutation	Average:14.282; most accessible tissue: Callus, score: 31.984	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409232620	NA	6.51E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0409232620	NA	3.59E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0409232620	NA	1.24E-10	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.03E-08	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.62E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.84E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	2.68E-06	1.27E-15	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.02E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	3.23E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.61E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.61E-13	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.26E-07	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.13E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	9.47E-14	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	3.65E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	8.90E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.51E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.52E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.18E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.09E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.39E-11	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.96E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.92E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.12E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.33E-13	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	8.59E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.67E-16	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	3.78E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	2.09E-07	7.40E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.82E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	9.13E-11	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.19E-16	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.42E-08	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.90E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.51E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.20E-11	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	9.35E-06	mr1282_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	6.43E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	4.25E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.51E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	7.47E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.74E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	8.99E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	6.32E-08	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	7.62E-10	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.96E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	6.51E-06	mr1748_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	2.38E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	5.21E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.37E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409232620	NA	1.03E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251