Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0409228132:

Variant ID: vg0409228132 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9228132
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGTCCGATCGGCATTGGCCGATCTGGGCCGTCCACGTGGTGGACGCGCACCCGAGGCACGTGTGGACCATGTCCACCGTGCGCCCTCCCCCTTTGACT[C/T]
GCTGACGTGTGGGGCCCGCGTGTCGGCGCCGGCCGCCCCTTGCTTGTAAAAATAAATAATAATTGCGTCATAATTCGATGATAATTCTAGAAATTCATTT

Reverse complement sequence

AAATGAATTTCTAGAATTATCATCGAATTATGACGCAATTATTATTTATTTTTACAAGCAAGGGGCGGCCGGCGCCGACACGCGGGCCCCACACGTCAGC[G/A]
AGTCAAAGGGGGAGGGCGCACGGTGGACATGGTCCACACGTGCCTCGGGTGCGCGTCCACCACGTGGACGGCCCAGATCGGCCAATGCCGATCGGACGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.50%	1.70%	7.85%	62.02%	NA
All Indica	2759	16.30%	0.00%	5.07%	78.58%	NA
All Japonica	1512	53.60%	5.10%	8.86%	32.41%	NA
Aus	269	19.70%	0.00%	18.22%	62.08%	NA
Indica I	595	13.10%	0.00%	5.71%	81.18%	NA
Indica II	465	18.30%	0.00%	2.80%	78.92%	NA
Indica III	913	17.00%	0.00%	6.02%	77.00%	NA
Indica Intermediate	786	16.90%	0.00%	4.83%	78.24%	NA
Temperate Japonica	767	82.40%	8.70%	5.22%	3.65%	NA
Tropical Japonica	504	4.00%	1.40%	16.07%	78.57%	NA
Japonica Intermediate	241	66.00%	1.20%	5.39%	27.39%	NA
VI/Aromatic	96	6.20%	0.00%	37.50%	56.25%	NA
Intermediate	90	26.70%	2.20%	13.33%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409228132	C -> DEL	N	N	silent_mutation	Average:38.73; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0409228132	C -> T	LOC_Os04g16850.1	upstream_gene_variant ; 467.0bp to feature; MODIFIER	silent_mutation	Average:38.73; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0409228132	C -> T	LOC_Os04g16860.1	upstream_gene_variant ; 2272.0bp to feature; MODIFIER	silent_mutation	Average:38.73; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N
vg0409228132	C -> T	LOC_Os04g16850-LOC_Os04g16860	intergenic_region ; MODIFIER	silent_mutation	Average:38.73; most accessible tissue: Zhenshan97 root, score: 75.275	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0409228132	C	T	0.0	0.0	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409228132	1.62E-06	6.39E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	4.65E-08	2.53E-13	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	1.34E-07	1.34E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	7.13E-06	2.57E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	1.14E-09	6.01E-13	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	4.56E-06	4.56E-06	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409228132	4.23E-07	5.25E-10	mr1631_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251