\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409221188:

Variant ID: vg0409221188 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9221188
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCACCACGGCATACGGACGGAAGACATGACATAGTTTCCAACCCATCCTAGCCATAGACAAGAGTACCGACCCAACCCCACCTACGGCCGGAACCTCC[A/G]
GGACAGGTAGGCAGGACTGAGCCCCTAGCAGCAGGACACCAGCCCTGTGCCATGACATCTCGACTACCGGGCCGTAGCTCGTGTAGCCTTTATTTGCCCT

Reverse complement sequence

AGGGCAAATAAAGGCTACACGAGCTACGGCCCGGTAGTCGAGATGTCATGGCACAGGGCTGGTGTCCTGCTGCTAGGGGCTCAGTCCTGCCTACCTGTCC[T/C]
GGAGGTTCCGGCCGTAGGTGGGGTTGGGTCGGTACTCTTGTCTATGGCTAGGATGGGTTGGAAACTATGTCATGTCTTCCGTCCGTATGCCGTGGTGGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.80% 13.70% 7.09% 57.45% NA
All Indica  2759 3.00% 0.60% 8.59% 87.86% NA
All Japonica  1512 61.00% 34.50% 3.77% 0.66% NA
Aus  269 1.50% 0.00% 13.01% 85.50% NA
Indica I  595 2.00% 0.00% 5.71% 92.27% NA
Indica II  465 2.80% 1.30% 6.24% 89.68% NA
Indica III  913 3.70% 0.30% 11.50% 84.45% NA
Indica Intermediate  786 2.90% 0.90% 8.78% 87.40% NA
Temperate Japonica  767 96.00% 2.60% 1.04% 0.39% NA
Tropical Japonica  504 4.40% 86.90% 8.33% 0.40% NA
Japonica Intermediate  241 68.50% 26.60% 2.90% 2.07% NA
VI/Aromatic  96 0.00% 83.30% 3.12% 13.54% NA
Intermediate  90 23.30% 31.10% 3.33% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409221188 A -> DEL N N silent_mutation Average:9.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0409221188 A -> G LOC_Os04g16810.1 upstream_gene_variant ; 3248.0bp to feature; MODIFIER silent_mutation Average:9.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0409221188 A -> G LOC_Os04g16850.1 downstream_gene_variant ; 2296.0bp to feature; MODIFIER silent_mutation Average:9.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0409221188 A -> G LOC_Os04g16810-LOC_Os04g16850 intergenic_region ; MODIFIER silent_mutation Average:9.397; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409221188 NA 3.33E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 2.32E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 2.89E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 1.44E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 2.78E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 5.22E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 8.02E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 8.30E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 1.49E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 6.09E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 4.19E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 NA 8.94E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409221188 3.30E-06 3.59E-06 mr1759_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251