\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409022880:

Variant ID: vg0409022880 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9022880
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTATTTGCATGAGTTTAACAACTTGGCTCGGTACGCCCCGGAGGATGTTCGTGAAGATGAGGAGAAGCAAGAGAAGTTCTTGGCAGGAATGGACCCT[A/G]
AGCTGTCCGTGCGTCTAGTCTCCGGTGACTATCCGGATTTCCAACGTCTGGTGGACAAGAGCATCCGCTTGGAAGCCAAGCACAAGGAACTGGAGTCTCA

Reverse complement sequence

TGAGACTCCAGTTCCTTGTGCTTGGCTTCCAAGCGGATGCTCTTGTCCACCAGACGTTGGAAATCCGGATAGTCACCGGAGACTAGACGCACGGACAGCT[T/C]
AGGGTCCATTCCTGCCAAGAACTTCTCTTGCTTCTCCTCATCTTCACGAACATCCTCCGGGGCGTACCGAGCCAAGTTGTTAAACTCATGCAAATACTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.90% 0.20% 42.70% 36.18% NA
All Indica  2759 1.40% 0.30% 55.42% 42.81% NA
All Japonica  1512 61.20% 0.10% 11.51% 27.18% NA
Aus  269 0.70% 0.00% 78.07% 21.19% NA
Indica I  595 2.00% 0.30% 41.18% 56.47% NA
Indica II  465 1.50% 0.00% 35.91% 62.58% NA
Indica III  913 1.00% 0.50% 78.31% 20.15% NA
Indica Intermediate  786 1.50% 0.30% 51.15% 47.07% NA
Temperate Japonica  767 96.10% 0.00% 0.91% 3.00% NA
Tropical Japonica  504 4.80% 0.40% 27.58% 67.26% NA
Japonica Intermediate  241 68.00% 0.00% 11.62% 20.33% NA
VI/Aromatic  96 0.00% 0.00% 76.04% 23.96% NA
Intermediate  90 22.20% 0.00% 35.56% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409022880 A -> DEL LOC_Os04g16590.1 N frameshift_variant Average:13.157; most accessible tissue: Callus, score: 24.86 N N N N
vg0409022880 A -> G LOC_Os04g16590.1 missense_variant ; p.Lys425Glu; MODERATE nonsynonymous_codon ; K425E Average:13.157; most accessible tissue: Callus, score: 24.86 possibly damaging -1.558 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409022880 NA 4.30E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 1.58E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 2.58E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 3.74E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 7.62E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 4.56E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 5.21E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 3.03E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 5.08E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 2.50E-06 1.59E-08 mr1716 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 2.27E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 1.06E-09 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 4.70E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 5.14E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 6.41E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 1.72E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409022880 NA 6.09E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251