\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409017235:

Variant ID: vg0409017235 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9017235
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGTCGGAAATGCCACCCAAACGCCATCAGTAACGCATCTGGGACGTCCACGCCAAACCACATGATCAACGGTGGAGATATGGGTTCGGCCGAACCGTG[G/A]
CCTGGCCCAACAGGCCTAGGTTTTGGCCTATGGACTCCCCATGATTTGCCTTATCCATTTCTGCAAATTTTGGGCCGACTGTCTAGTGTTTCAATGAAGT

Reverse complement sequence

ACTTCATTGAAACACTAGACAGTCGGCCCAAAATTTGCAGAAATGGATAAGGCAAATCATGGGGAGTCCATAGGCCAAAACCTAGGCCTGTTGGGCCAGG[C/T]
CACGGTTCGGCCGAACCCATATCTCCACCGTTGATCATGTGGTTTGGCGTGGACGTCCCAGATGCGTTACTGATGGCGTTTGGGTGGCATTTCCGACAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.40% 0.40% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.30% 7.50% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 84.40% 13.40% 2.22% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409017235 G -> A LOC_Os04g16570.1 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:49.946; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0409017235 G -> A LOC_Os04g16590.1 upstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:49.946; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0409017235 G -> A LOC_Os04g16580.1 intron_variant ; MODIFIER silent_mutation Average:49.946; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409017235 1.70E-07 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 NA 3.46E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 2.00E-09 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 3.25E-06 3.56E-11 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 4.66E-08 1.40E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 1.17E-07 1.17E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 1.61E-06 NA mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 NA 5.01E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 2.21E-07 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 NA 1.18E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 1.91E-08 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 7.90E-06 2.65E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 7.66E-08 7.65E-08 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 1.79E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409017235 NA 3.28E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251