\
| Variant ID: vg0408995582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8995582 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )
GGCTGGTAAAGACTCAATGATTGGGTCTCTAAATAAAGAACAAGGACCACCTCATGTTCAGCCAGGAACATCCTCAGGTAACATATCTTATCAAGTGATG[C/G]
CGATTTAAATAACTTCAGCTTACTCGTCTAATGTCTTGGAAATACATCAGGAACACTAGGCGATGACGAAGAAACAATTCCTCGCATAAAGGCGGCTGAT
ATCAGCCGCCTTTATGCGAGGAATTGTTTCTTCGTCATCGCCTAGTGTTCCTGATGTATTTCCAAGACATTAGACGAGTAAGCTGAAGTTATTTAAATCG[G/C]
CATCACTTGATAAGATATGTTACCTGAGGATGTTCCTGGCTGAACATGAGGTGGTCCTTGTTCTTTATTTAGAGACCCAATCATTGAGTCTTTACCAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.10% | 5.40% | 10.64% | 51.82% | NA |
| All Indica | 2759 | 8.70% | 9.10% | 7.10% | 75.06% | NA |
| All Japonica | 1512 | 71.00% | 0.00% | 11.31% | 17.72% | NA |
| Aus | 269 | 45.40% | 0.00% | 30.48% | 24.16% | NA |
| Indica I | 595 | 6.60% | 4.00% | 2.86% | 86.55% | NA |
| Indica II | 465 | 3.70% | 27.70% | 6.02% | 62.58% | NA |
| Indica III | 913 | 9.90% | 0.30% | 9.20% | 80.61% | NA |
| Indica Intermediate | 786 | 12.10% | 12.10% | 8.52% | 67.30% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 18.70% | 0.00% | 32.54% | 48.81% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 2.90% | 7.05% | NA |
| VI/Aromatic | 96 | 39.60% | 0.00% | 42.71% | 17.71% | NA |
| Intermediate | 90 | 48.90% | 5.60% | 14.44% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408995582 | C -> DEL | N | N | silent_mutation | Average:6.295; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg0408995582 | C -> G | LOC_Os04g16550.1 | downstream_gene_variant ; 1518.0bp to feature; MODIFIER | silent_mutation | Average:6.295; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| vg0408995582 | C -> G | LOC_Os04g16540.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.295; most accessible tissue: Zhenshan97 root, score: 12.891 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408995582 | NA | 2.89E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 1.51E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 1.09E-07 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 1.10E-13 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 5.53E-09 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 9.53E-08 | mr1304_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 2.68E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 2.16E-17 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | NA | 9.72E-15 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | 3.05E-08 | 8.32E-30 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408995582 | 9.62E-09 | 1.25E-26 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |