\
| Variant ID: vg0408888649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8888649 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATACCGGCGCATCCTCTCAAAAGCTAACCTCAAATCGGCCATGTGTCCTTCTATACCATCCGATTTGACAACAATATCGTCAATATAGATCTCTAAGATA[A/G,T]
TACCTAGCAAATCATGAAAGATCAAATTCATCTCCCTTTGTATATGTTGCACCGGCGTTCTTCAACCCAAAAGTCATGACAACCCACTCAAACAAACCTA
TAGGTTTGTTTGAGTGGGTTGTCATGACTTTTGGGTTGAAGAACGCCGGTGCAACATATACAAAGGGAGATGAATTTGATCTTTCATGATTTGCTAGGTA[T/C,A]
TATCTTAGAGATCTATATTGACGATATTGTTGTCAAATCGGATGGTATAGAAGGACACATGGCCGATTTGAGGTTAGCTTTTGAGAGGATGCGCCGGTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 2.10% | 1.16% | 12.74% | T: 0.06% |
| All Indica | 2759 | 95.80% | 3.50% | 0.36% | 0.29% | NA |
| All Japonica | 1512 | 63.60% | 0.10% | 1.65% | 34.66% | T: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.30% | 1.01% | 0.00% | NA |
| Indica II | 465 | 87.30% | 11.60% | 0.22% | 0.86% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 95.00% | 4.30% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 96.20% | 0.10% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 9.30% | 0.00% | 4.37% | 86.11% | T: 0.20% |
| Japonica Intermediate | 241 | 73.00% | 0.00% | 1.24% | 25.73% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 18.75% | 57.29% | NA |
| Intermediate | 90 | 77.80% | 1.10% | 2.22% | 16.67% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408888649 | A -> DEL | LOC_Os04g16350.1 | N | frameshift_variant | Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417 | N | N | N | N |
| vg0408888649 | A -> G | LOC_Os04g16350.1 | missense_variant ; p.Ile74Thr; MODERATE | nonsynonymous_codon ; I74T | Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417 | benign |
0.536 |
TOLERATED | 0.08 |
| vg0408888649 | A -> T | LOC_Os04g16350.1 | missense_variant ; p.Ile74Asn; MODERATE | nonsynonymous_codon ; I74N | Average:22.348; most accessible tissue: Zhenshan97 flag leaf, score: 29.417 | benign |
1.238 |
TOLERATED | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408888649 | 7.42E-08 | 9.68E-12 | mr1310 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 9.10E-15 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 4.98E-10 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 4.26E-09 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 3.34E-09 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 6.35E-08 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 1.53E-09 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 1.90E-11 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408888649 | NA | 1.79E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |