Search for Variation information by Variation ID:
Detailed information for vg0408820718:
| Variant ID: vg0408820718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8820718 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GTTCGTCAGTCCCTGGCGTGGACCTGCTTCGTCGAGACCCCTCGTGCCGAGCCCGCGCCCGTGGTTCCTCAGGAGGAGGGAGCCTCCGGCGTTGGTAGCA[C/G]
GGAGGATGCGCTGCTGCTCACCTTCCACCCTGGCCCGTCGCAGAAGTAGACGAGTAGTTAGTAGGCTTGCGCGTGTGTTCTTCTCGTTTGTTTTTCTGCT
Reverse complement sequence
AGCAGAAAAACAAACGAGAAGAACACACGCGCAAGCCTACTAACTACTCGTCTACTTCTGCGACGGGCCAGGGTGGAAGGTGAGCAGCAGCGCATCCTCC[G/C]
TGCTACCAACGCCGGAGGCTCCCTCCTCCTGAGGAACCACGGGCGCGGGCTCGGCACGAGGGGTCTCGACGAAGCAGGTCCACGCCAGGGACTGACGAAC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 1.60% | 9.78% | 34.70% | NA |
| All Indica | 2759 | 42.40% | 0.10% | 11.82% | 45.67% | NA |
| All Japonica | 1512 | 75.40% | 4.60% | 4.43% | 15.54% | NA |
| Aus | 269 | 40.10% | 0.00% | 22.30% | 37.55% | NA |
| Indica I | 595 | 29.70% | 0.00% | 4.54% | 65.71% | NA |
| Indica II | 465 | 40.90% | 0.00% | 14.41% | 44.73% | NA |
| Indica III | 913 | 51.90% | 0.10% | 16.10% | 31.87% | NA |
| Indica Intermediate | 786 | 41.90% | 0.30% | 10.81% | 47.07% | NA |
| Temperate Japonica | 767 | 82.30% | 8.30% | 6.26% | 3.13% | NA |
| Tropical Japonica | 504 | 62.10% | 0.80% | 2.38% | 34.72% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.80% | 2.90% | 14.94% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 0.00% | 21.88% | NA |
| Intermediate | 90 | 62.20% | 2.20% | 10.00% | 25.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408820718 | C -> DEL | LOC_Os04g16240.1 | N | frameshift_variant | Average:20.54; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0408820718 | C -> G | LOC_Os04g16240.1 | missense_variant ; p.Thr284Arg; MODERATE | nonsynonymous_codon ; T284R | Average:20.54; most accessible tissue: Zhenshan97 panicle, score: 36.038 | possibly damaging  |
1.999 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408820718 | 4.11E-06 | 1.92E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 4.51E-07 | 3.35E-12 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 1.61E-07 | 1.61E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 7.97E-06 | 4.32E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 5.69E-10 | 2.49E-13 | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 2.13E-06 | 2.13E-06 | mr1525_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408820718 | 4.56E-06 | 8.87E-09 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |