\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408768585:

Variant ID: vg0408768585 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8768585
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTCTTTTATGTCCATCTCCTTGCCAATAAAACGTAGATCTAAAGTAATCCAATTTCTTGATTACGCCTTTAGGTATAGCAAAGAAGGACATCATA[T/C]
GCATCGGCAAACTTGTGAGAACCGAATTGATGAGCGTCAGTCTCCCCCCAAGAGAAAGAAGTTTGCCTTTCCAACTTGCTAGTCGTTTCTCAAAATGTTC

Reverse complement sequence

GAACATTTTGAGAAACGACTAGCAAGTTGGAAAGGCAAACTTCTTTCTCTTGGGGGGAGACTGACGCTCATCAATTCGGTTCTCACAAGTTTGCCGATGC[A/G]
TATGATGTCCTTCTTTGCTATACCTAAAGGCGTAATCAAGAAATTGGATTACTTTAGATCTACGTTTTATTGGCAAGGAGATGGACATAAAAGAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 34.90% 0.11% 1.25% NA
All Indica  2759 96.80% 1.10% 0.07% 2.10% NA
All Japonica  1512 1.10% 98.80% 0.07% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 89.00% 3.20% 0.00% 7.74% NA
Indica III  913 98.10% 0.40% 0.00% 1.42% NA
Indica Intermediate  786 97.50% 1.10% 0.25% 1.15% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.10% 0.41% 0.41% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408768585 T -> C LOC_Os04g16140.1 downstream_gene_variant ; 4479.0bp to feature; MODIFIER silent_mutation Average:41.463; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0408768585 T -> C LOC_Os04g16150.1 downstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:41.463; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0408768585 T -> C LOC_Os04g16140-LOC_Os04g16150 intergenic_region ; MODIFIER silent_mutation Average:41.463; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0408768585 T -> DEL N N silent_mutation Average:41.463; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408768585 NA 2.12E-71 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 4.97E-90 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.05E-79 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.03E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.54E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 4.80E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 3.91E-36 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.76E-38 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.63E-52 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.71E-74 mr1896 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.30E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 6.84E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 6.46E-81 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.17E-79 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 3.32E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 6.95E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.96E-105 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.17E-103 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.35E-100 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.92E-62 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 7.48E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 5.11E-80 mr1563_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 2.86E-122 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 2.79E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.33E-69 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 4.65E-66 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 2.50E-95 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 1.22E-82 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408768585 NA 4.74E-124 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251