\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408695325:

Variant ID: vg0408695325 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8695325
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGCACGCGTCGACCATGAGGAAGGATTATTTTTGTAATTTATGTACGTAGTTTATGTCTACATGTCTGTTATCTGTATGACTAATATGTTCGGAAT[G/A]
ATCAATAGTATATTGCTTATGAAATAGTCAAATAAAATAATTAAGTGAAGCACCCACTAGAAGTGAAATAAAATAATTAAGCAAGTATAACCATTGGAAA

Reverse complement sequence

TTTCCAATGGTTATACTTGCTTAATTATTTTATTTCACTTCTAGTGGGTGCTTCACTTAATTATTTTATTTGACTATTTCATAAGCAATATACTATTGAT[C/T]
ATTCCGAACATATTAGTCATACAGATAACAGACATGTAGACATAAACTACGTACATAAATTACAAAAATAATCCTTCCTCATGGTCGACGCGTGCATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.80% 0.02% 0.00% NA
All Indica  2759 97.80% 2.10% 0.04% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408695325 G -> A LOC_Os04g16030.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0408695325 G -> A LOC_Os04g16010.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0408695325 G -> A LOC_Os04g16020.1 downstream_gene_variant ; 496.0bp to feature; MODIFIER silent_mutation Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0408695325 G -> A LOC_Os04g16010-LOC_Os04g16020 intergenic_region ; MODIFIER silent_mutation Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408695325 NA 1.32E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408695325 NA 5.84E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408695325 NA 3.63E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408695325 4.99E-06 5.82E-09 mr1748_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408695325 1.98E-06 NA mr1748_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408695325 NA 4.54E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251