Variant ID: vg0408695325 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 8695325 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 93. )
AATATGCACGCGTCGACCATGAGGAAGGATTATTTTTGTAATTTATGTACGTAGTTTATGTCTACATGTCTGTTATCTGTATGACTAATATGTTCGGAAT[G/A]
ATCAATAGTATATTGCTTATGAAATAGTCAAATAAAATAATTAAGTGAAGCACCCACTAGAAGTGAAATAAAATAATTAAGCAAGTATAACCATTGGAAA
TTTCCAATGGTTATACTTGCTTAATTATTTTATTTCACTTCTAGTGGGTGCTTCACTTAATTATTTTATTTGACTATTTCATAAGCAATATACTATTGAT[C/T]
ATTCCGAACATATTAGTCATACAGATAACAGACATGTAGACATAAACTACGTACATAAATTACAAAAATAATCCTTCCTCATGGTCGACGCGTGCATATT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.20% | 35.80% | 0.02% | 0.00% | NA |
All Indica | 2759 | 97.80% | 2.10% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.60% | 3.30% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0408695325 | G -> A | LOC_Os04g16030.1 | upstream_gene_variant ; 2229.0bp to feature; MODIFIER | silent_mutation | Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg0408695325 | G -> A | LOC_Os04g16010.1 | downstream_gene_variant ; 60.0bp to feature; MODIFIER | silent_mutation | Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg0408695325 | G -> A | LOC_Os04g16020.1 | downstream_gene_variant ; 496.0bp to feature; MODIFIER | silent_mutation | Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
vg0408695325 | G -> A | LOC_Os04g16010-LOC_Os04g16020 | intergenic_region ; MODIFIER | silent_mutation | Average:27.305; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0408695325 | NA | 1.32E-10 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0408695325 | NA | 5.84E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0408695325 | NA | 3.63E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0408695325 | 4.99E-06 | 5.82E-09 | mr1748_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0408695325 | 1.98E-06 | NA | mr1748_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0408695325 | NA | 4.54E-36 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |