Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408634359:

Variant ID: vg0408634359 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8634359
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

ATGATCCACCCACCACATTCAGTAAGATGGAAATCTTAGTAAAAAAATCACTAACGTCTTTATGTTTTCTCACAATATCCACAAGAACCAATTGGAGTTG[G/A,T]
TGAGCAAAACAGTGAACATAATAAGCTGAACTATATTCCCTCATGATCAATGATTGCAAACCATTGAACTCACCTCGCATATTGCTAGCACCGTCATATC

Reverse complement sequence

GATATGACGGTGCTAGCAATATGCGAGGTGAGTTCAATGGTTTGCAATCATTGATCATGAGGGAATATAGTTCAGCTTATTATGTTCACTGTTTTGCTCA[C/T,A]
CAACTCCAATTGGTTCTTGTGGATATTGTGAGAAAACATAAAGACGTTAGTGATTTTTTTACTAAGATTTCCATCTTACTGAATGTGGTGGGTGGATCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.80%	1.90%	29.73%	26.43%	A: 0.13%
All Indica	2759	19.90%	0.00%	39.00%	40.99%	A: 0.07%
All Japonica	1512	81.70%	5.80%	7.80%	4.56%	A: 0.13%
Aus	269	21.20%	0.00%	67.29%	11.52%	NA
Indica I	595	34.80%	0.00%	17.14%	48.07%	NA
Indica II	465	24.50%	0.00%	43.01%	32.47%	NA
Indica III	913	4.20%	0.00%	54.65%	40.96%	A: 0.22%
Indica Intermediate	786	24.30%	0.00%	34.99%	40.71%	NA
Temperate Japonica	767	72.50%	10.60%	11.34%	5.61%	NA
Tropical Japonica	504	97.40%	0.60%	0.60%	1.19%	A: 0.20%
Japonica Intermediate	241	78.00%	1.70%	11.62%	8.30%	A: 0.41%
VI/Aromatic	96	88.50%	0.00%	8.33%	1.04%	A: 2.08%
Intermediate	90	55.60%	1.10%	24.44%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408634359	G -> DEL	LOC_Os04g15910.1	N	frameshift_variant	Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0408634359	G -> A	LOC_Os04g15910.1	synonymous_variant ; p.His243His; LOW	synonymous_codon	Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0408634359	G -> T	LOC_Os04g15910.1	missense_variant ; p.His243Gln; MODERATE	nonsynonymous_codon ; H243Q	Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381	probably damaging	2.083	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408634359	1.70E-07	NA	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	NA	2.98E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	1.09E-09	NA	mr1062	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	2.20E-06	2.17E-11	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	1.43E-07	4.19E-09	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	3.51E-07	3.51E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	2.86E-06	NA	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	NA	7.05E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	1.41E-07	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	NA	6.54E-07	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	9.96E-09	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	5.38E-06	1.56E-09	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	1.43E-07	1.42E-07	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	2.46E-08	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359	NA	3.08E-09	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251