\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408634359:

Variant ID: vg0408634359 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8634359
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


ATGATCCACCCACCACATTCAGTAAGATGGAAATCTTAGTAAAAAAATCACTAACGTCTTTATGTTTTCTCACAATATCCACAAGAACCAATTGGAGTTG[G/A,T]
TGAGCAAAACAGTGAACATAATAAGCTGAACTATATTCCCTCATGATCAATGATTGCAAACCATTGAACTCACCTCGCATATTGCTAGCACCGTCATATC

Reverse complement sequence

GATATGACGGTGCTAGCAATATGCGAGGTGAGTTCAATGGTTTGCAATCATTGATCATGAGGGAATATAGTTCAGCTTATTATGTTCACTGTTTTGCTCA[C/T,A]
CAACTCCAATTGGTTCTTGTGGATATTGTGAGAAAACATAAAGACGTTAGTGATTTTTTTACTAAGATTTCCATCTTACTGAATGTGGTGGGTGGATCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 1.90% 29.73% 26.43% A: 0.13%
All Indica  2759 19.90% 0.00% 39.00% 40.99% A: 0.07%
All Japonica  1512 81.70% 5.80% 7.80% 4.56% A: 0.13%
Aus  269 21.20% 0.00% 67.29% 11.52% NA
Indica I  595 34.80% 0.00% 17.14% 48.07% NA
Indica II  465 24.50% 0.00% 43.01% 32.47% NA
Indica III  913 4.20% 0.00% 54.65% 40.96% A: 0.22%
Indica Intermediate  786 24.30% 0.00% 34.99% 40.71% NA
Temperate Japonica  767 72.50% 10.60% 11.34% 5.61% NA
Tropical Japonica  504 97.40% 0.60% 0.60% 1.19% A: 0.20%
Japonica Intermediate  241 78.00% 1.70% 11.62% 8.30% A: 0.41%
VI/Aromatic  96 88.50% 0.00% 8.33% 1.04% A: 2.08%
Intermediate  90 55.60% 1.10% 24.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408634359 G -> DEL LOC_Os04g15910.1 N frameshift_variant Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0408634359 G -> A LOC_Os04g15910.1 synonymous_variant ; p.His243His; LOW synonymous_codon Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0408634359 G -> T LOC_Os04g15910.1 missense_variant ; p.His243Gln; MODERATE nonsynonymous_codon ; H243Q Average:27.555; most accessible tissue: Minghui63 young leaf, score: 39.381 probably damaging 2.083 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408634359 1.70E-07 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 NA 2.98E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 1.09E-09 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 2.20E-06 2.17E-11 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 1.43E-07 4.19E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 3.51E-07 3.51E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 2.86E-06 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 NA 7.05E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 1.41E-07 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 NA 6.54E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 9.96E-09 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 5.38E-06 1.56E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 1.43E-07 1.42E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 2.46E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408634359 NA 3.08E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251