\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408590224:

Variant ID: vg0408590224 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8590224
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAGCTTTCTCAACTCCAAGTGGATCTATTGCAACCAACACAGTGGCTCTCCCTGCTGACCATGTATGTGTCTTACTTCTGAGATAAGTCTGTTTTAGT[C/T]
GAATTTCCTATTTTTATTATAGGAAATATCCAATTTGAGAAATGAATTGAGATATTACCCTACCTACTCTGTTATATGGCTTCAAGTATTTATACTTGCT

Reverse complement sequence

AGCAAGTATAAATACTTGAAGCCATATAACAGAGTAGGTAGGGTAATATCTCAATTCATTTCTCAAATTGGATATTTCCTATAATAAAAATAGGAAATTC[G/A]
ACTAAAACAGACTTATCTCAGAAGTAAGACACATACATGGTCAGCAGGGAGAGCCACTGTGTTGGTTGCAATAGATCCACTTGGAGTTGAGAAAGCTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.50% 0.04% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 62.40% 37.60% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 6.90% 92.90% 0.20% 0.00% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408590224 C -> T LOC_Os04g15820.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15820.1 5_prime_UTR_variant ; 1206.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15800.1 upstream_gene_variant ; 1919.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15790.1 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15790.2 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15790.3 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N
vg0408590224 C -> T LOC_Os04g15790.4 downstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408590224 NA 6.46E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 6.14E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 2.72E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 3.57E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 1.16E-12 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 2.29E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 1.15E-08 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 8.48E-14 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 5.04E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 2.92E-06 2.92E-06 mr1703 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 2.07E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 6.18E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 2.58E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 1.48E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 3.88E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 4.58E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 4.98E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224 NA 2.86E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251