Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408590224:

Variant ID: vg0408590224 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8590224
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TTGAGCTTTCTCAACTCCAAGTGGATCTATTGCAACCAACACAGTGGCTCTCCCTGCTGACCATGTATGTGTCTTACTTCTGAGATAAGTCTGTTTTAGT[C/T]
GAATTTCCTATTTTTATTATAGGAAATATCCAATTTGAGAAATGAATTGAGATATTACCCTACCTACTCTGTTATATGGCTTCAAGTATTTATACTTGCT

Reverse complement sequence

AGCAAGTATAAATACTTGAAGCCATATAACAGAGTAGGTAGGGTAATATCTCAATTCATTTCTCAAATTGGATATTTCCTATAATAAAAATAGGAAATTC[G/A]
ACTAAAACAGACTTATCTCAGAAGTAAGACACATACATGGTCAGCAGGGAGAGCCACTGTGTTGGTTGCAATAGATCCACTTGGAGTTGAGAAAGCTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.50%	0.04%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	62.40%	37.60%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.90%	0.00%	0.00%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	6.90%	92.90%	0.20%	0.00%	NA
Japonica Intermediate	241	70.50%	29.50%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408590224	C -> T	LOC_Os04g15820.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15820.1	5_prime_UTR_variant ; 1206.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15800.1	upstream_gene_variant ; 1919.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15790.1	downstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15790.2	downstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15790.3	downstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N
vg0408590224	C -> T	LOC_Os04g15790.4	downstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:64.204; most accessible tissue: Minghui63 flag leaf, score: 84.791	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408590224	NA	6.46E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	6.14E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	2.72E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	3.57E-11	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	1.16E-12	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	2.29E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	1.15E-08	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	8.48E-14	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	5.04E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	2.92E-06	2.92E-06	mr1703	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	2.07E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	6.18E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	2.58E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	1.48E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	3.88E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	4.58E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	4.98E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408590224	NA	2.86E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251