Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408524000:

Variant ID: vg0408524000 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8524000
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGCTGTTATTAGGACATGTGGGTTACTGTAGCACTTATGGCTAATCATGGACTAATTAGGCTTAAAAATTTGTCTCGCAATTTTCCATGCAAACTGTG[C/T]
AATTAATTTTTGTTTTTATCTATATTTAATGTTCCATGCACATGTGTAAAGATTCGATGTGATGTTTTTGGGAAAAAAATTAGGAACTAAACCTGGCCTT

Reverse complement sequence

AAGGCCAGGTTTAGTTCCTAATTTTTTTCCCAAAAACATCACATCGAATCTTTACACATGTGCATGGAACATTAAATATAGATAAAAACAAAAATTAATT[G/A]
CACAGTTTGCATGGAAAATTGCGAGACAAATTTTTAAGCCTAATTAGTCCATGATTAGCCATAAGTGCTACAGTAACCCACATGTCCTAATAACAGCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.70%	25.70%	0.06%	0.51%	NA
All Indica	2759	61.90%	37.90%	0.11%	0.00%	NA
All Japonica	1512	97.40%	1.10%	0.00%	1.59%	NA
Aus	269	53.50%	46.50%	0.00%	0.00%	NA
Indica I	595	77.50%	22.50%	0.00%	0.00%	NA
Indica II	465	50.50%	49.20%	0.22%	0.00%	NA
Indica III	913	64.30%	35.60%	0.11%	0.00%	NA
Indica Intermediate	786	54.20%	45.70%	0.13%	0.00%	NA
Temperate Japonica	767	96.60%	0.30%	0.00%	3.13%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408524000	C -> DEL	N	N	silent_mutation	Average:29.695; most accessible tissue: Callus, score: 41.104	N	N	N	N
vg0408524000	C -> T	LOC_Os04g15680.1	upstream_gene_variant ; 4131.0bp to feature; MODIFIER	silent_mutation	Average:29.695; most accessible tissue: Callus, score: 41.104	N	N	N	N
vg0408524000	C -> T	LOC_Os04g15690.1	upstream_gene_variant ; 4512.0bp to feature; MODIFIER	silent_mutation	Average:29.695; most accessible tissue: Callus, score: 41.104	N	N	N	N
vg0408524000	C -> T	LOC_Os04g15670.1	downstream_gene_variant ; 4741.0bp to feature; MODIFIER	silent_mutation	Average:29.695; most accessible tissue: Callus, score: 41.104	N	N	N	N
vg0408524000	C -> T	LOC_Os04g15680-LOC_Os04g15690	intergenic_region ; MODIFIER	silent_mutation	Average:29.695; most accessible tissue: Callus, score: 41.104	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408524000	NA	5.33E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.30E-14	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	3.51E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	4.70E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	3.25E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.13E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	5.20E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.43E-18	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.48E-09	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	4.36E-06	mr1833	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	1.69E-08	3.94E-26	mr1846	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	7.03E-08	2.91E-15	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.37E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	1.64E-18	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	NA	2.71E-14	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	1.18E-11	2.37E-49	mr1846_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000	9.80E-12	7.07E-32	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251