\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408524000:

Variant ID: vg0408524000 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8524000
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTGTTATTAGGACATGTGGGTTACTGTAGCACTTATGGCTAATCATGGACTAATTAGGCTTAAAAATTTGTCTCGCAATTTTCCATGCAAACTGTG[C/T]
AATTAATTTTTGTTTTTATCTATATTTAATGTTCCATGCACATGTGTAAAGATTCGATGTGATGTTTTTGGGAAAAAAATTAGGAACTAAACCTGGCCTT

Reverse complement sequence

AAGGCCAGGTTTAGTTCCTAATTTTTTTCCCAAAAACATCACATCGAATCTTTACACATGTGCATGGAACATTAAATATAGATAAAAACAAAAATTAATT[G/A]
CACAGTTTGCATGGAAAATTGCGAGACAAATTTTTAAGCCTAATTAGTCCATGATTAGCCATAAGTGCTACAGTAACCCACATGTCCTAATAACAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 25.70% 0.06% 0.51% NA
All Indica  2759 61.90% 37.90% 0.11% 0.00% NA
All Japonica  1512 97.40% 1.10% 0.00% 1.59% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 77.50% 22.50% 0.00% 0.00% NA
Indica II  465 50.50% 49.20% 0.22% 0.00% NA
Indica III  913 64.30% 35.60% 0.11% 0.00% NA
Indica Intermediate  786 54.20% 45.70% 0.13% 0.00% NA
Temperate Japonica  767 96.60% 0.30% 0.00% 3.13% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408524000 C -> DEL N N silent_mutation Average:29.695; most accessible tissue: Callus, score: 41.104 N N N N
vg0408524000 C -> T LOC_Os04g15680.1 upstream_gene_variant ; 4131.0bp to feature; MODIFIER silent_mutation Average:29.695; most accessible tissue: Callus, score: 41.104 N N N N
vg0408524000 C -> T LOC_Os04g15690.1 upstream_gene_variant ; 4512.0bp to feature; MODIFIER silent_mutation Average:29.695; most accessible tissue: Callus, score: 41.104 N N N N
vg0408524000 C -> T LOC_Os04g15670.1 downstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:29.695; most accessible tissue: Callus, score: 41.104 N N N N
vg0408524000 C -> T LOC_Os04g15680-LOC_Os04g15690 intergenic_region ; MODIFIER silent_mutation Average:29.695; most accessible tissue: Callus, score: 41.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408524000 NA 5.33E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.30E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 3.51E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 4.70E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 3.25E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.13E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 5.20E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.43E-18 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.48E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 4.36E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 1.69E-08 3.94E-26 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 7.03E-08 2.91E-15 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.37E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 1.64E-18 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 NA 2.71E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 1.18E-11 2.37E-49 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408524000 9.80E-12 7.07E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251