Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408495393:

Variant ID: vg0408495393 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8495393
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTGGCTCAGAGTTCCCCTTAGCTGGAATCCTGCCCCCCCGACTACGCACGGTTTGCTCTTGTTCGGTTGGGGTTTGAGGAAGAAGATTCGGCGAAA[C/T]
AGGGCAAAGTGAGGCTTGATTCCCAAAAAGGCTTCACAAACATGGACGAAATTGGCGATATGCACTATGGAATTTGGGTTTAGGTGATGCAAGCTGATTC

Reverse complement sequence

GAATCAGCTTGCATCACCTAAACCCAAATTCCATAGTGCATATCGCCAATTTCGTCCATGTTTGTGAAGCCTTTTTGGGAATCAAGCCTCACTTTGCCCT[G/A]
TTTCGCCGAATCTTCTTCCTCAAACCCCAACCGAACAAGAGCAAACCGTGCGTAGTCGGGGGGGCAGGATTCCAGCTAAGGGGAACTCTGAGCCAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	0.40%	5.80%	65.83%	NA
All Indica	2759	9.40%	0.30%	5.11%	85.25%	NA
All Japonica	1512	66.90%	0.70%	3.31%	29.03%	NA
Aus	269	6.70%	0.00%	20.45%	72.86%	NA
Indica I	595	11.90%	0.20%	6.05%	81.85%	NA
Indica II	465	5.20%	0.20%	5.38%	89.25%	NA
Indica III	913	10.00%	0.10%	5.26%	84.67%	NA
Indica Intermediate	786	9.30%	0.50%	4.07%	86.13%	NA
Temperate Japonica	767	97.70%	0.00%	0.39%	1.96%	NA
Tropical Japonica	504	13.90%	1.60%	6.55%	77.98%	NA
Japonica Intermediate	241	80.10%	1.20%	5.81%	12.86%	NA
VI/Aromatic	96	6.20%	0.00%	22.92%	70.83%	NA
Intermediate	90	31.10%	0.00%	6.67%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408495393	C -> DEL	LOC_Os04g15620.1	N	frameshift_variant	Average:6.801; most accessible tissue: Minghui63 flower, score: 11.139	N	N	N	N
vg0408495393	C -> T	LOC_Os04g15620.1	synonymous_variant ; p.Leu115Leu; LOW	synonymous_codon	Average:6.801; most accessible tissue: Minghui63 flower, score: 11.139	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408495393	NA	6.02E-07	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	5.24E-08	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	9.77E-06	9.77E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	1.23E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	2.14E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	3.05E-06	3.05E-06	mr1506_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	7.54E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	1.94E-07	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	7.06E-07	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	7.43E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	8.05E-06	8.05E-06	mr1811_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393	NA	6.95E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251