\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408495393:

Variant ID: vg0408495393 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8495393
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTGGCTCAGAGTTCCCCTTAGCTGGAATCCTGCCCCCCCGACTACGCACGGTTTGCTCTTGTTCGGTTGGGGTTTGAGGAAGAAGATTCGGCGAAA[C/T]
AGGGCAAAGTGAGGCTTGATTCCCAAAAAGGCTTCACAAACATGGACGAAATTGGCGATATGCACTATGGAATTTGGGTTTAGGTGATGCAAGCTGATTC

Reverse complement sequence

GAATCAGCTTGCATCACCTAAACCCAAATTCCATAGTGCATATCGCCAATTTCGTCCATGTTTGTGAAGCCTTTTTGGGAATCAAGCCTCACTTTGCCCT[G/A]
TTTCGCCGAATCTTCTTCCTCAAACCCCAACCGAACAAGAGCAAACCGTGCGTAGTCGGGGGGGCAGGATTCCAGCTAAGGGGAACTCTGAGCCAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 0.40% 5.80% 65.83% NA
All Indica  2759 9.40% 0.30% 5.11% 85.25% NA
All Japonica  1512 66.90% 0.70% 3.31% 29.03% NA
Aus  269 6.70% 0.00% 20.45% 72.86% NA
Indica I  595 11.90% 0.20% 6.05% 81.85% NA
Indica II  465 5.20% 0.20% 5.38% 89.25% NA
Indica III  913 10.00% 0.10% 5.26% 84.67% NA
Indica Intermediate  786 9.30% 0.50% 4.07% 86.13% NA
Temperate Japonica  767 97.70% 0.00% 0.39% 1.96% NA
Tropical Japonica  504 13.90% 1.60% 6.55% 77.98% NA
Japonica Intermediate  241 80.10% 1.20% 5.81% 12.86% NA
VI/Aromatic  96 6.20% 0.00% 22.92% 70.83% NA
Intermediate  90 31.10% 0.00% 6.67% 62.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408495393 C -> DEL LOC_Os04g15620.1 N frameshift_variant Average:6.801; most accessible tissue: Minghui63 flower, score: 11.139 N N N N
vg0408495393 C -> T LOC_Os04g15620.1 synonymous_variant ; p.Leu115Leu; LOW synonymous_codon Average:6.801; most accessible tissue: Minghui63 flower, score: 11.139 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408495393 NA 6.02E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 5.24E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 9.77E-06 9.77E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 1.23E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 2.14E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 3.05E-06 3.05E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 7.54E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 1.94E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 7.06E-07 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 7.43E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 8.05E-06 8.05E-06 mr1811_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408495393 NA 6.95E-06 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251