\
| Variant ID: vg0408484082 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8484082 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 105. )
TTGGTTGGACTATTATCGTAACAACTTTCTCATTTTCTGTTAGTATATTTCGTAAACTGCTACTTCCTCCGTTTCACAATGTAAGTCATTTTAGCATTTT[C/T]
CATATTCATATTGATGTTAATAATGAATCGAAACATATATATCTATCTAGATTCATTAGCATCTATATGAATGTGGGAAATGCTAGAATGACTTACATTG
CAATGTAAGTCATTCTAGCATTTCCCACATTCATATAGATGCTAATGAATCTAGATAGATATATATGTTTCGATTCATTATTAACATCAATATGAATATG[G/A]
AAAATGCTAAAATGACTTACATTGTGAAACGGAGGAAGTAGCAGTTTACGAAATATACTAACAGAAAATGAGAAAGTTGTTACGATAATAGTCCAACCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.50% | 30.70% | 1.76% | 27.99% | NA |
| All Indica | 2759 | 9.10% | 46.90% | 2.17% | 41.79% | NA |
| All Japonica | 1512 | 88.20% | 9.60% | 0.93% | 1.32% | NA |
| Aus | 269 | 52.80% | 0.00% | 2.23% | 44.98% | NA |
| Indica I | 595 | 0.30% | 76.80% | 1.18% | 21.68% | NA |
| Indica II | 465 | 24.30% | 25.60% | 2.80% | 47.31% | NA |
| Indica III | 913 | 7.40% | 40.90% | 1.75% | 49.95% | NA |
| Indica Intermediate | 786 | 8.80% | 43.90% | 3.05% | 44.27% | NA |
| Temperate Japonica | 767 | 92.80% | 5.90% | 0.91% | 0.39% | NA |
| Tropical Japonica | 504 | 96.40% | 1.00% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 56.00% | 39.40% | 2.90% | 1.66% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 52.20% | 15.60% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408484082 | C -> DEL | N | N | silent_mutation | Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0408484082 | C -> T | LOC_Os04g15590.1 | upstream_gene_variant ; 1451.0bp to feature; MODIFIER | silent_mutation | Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0408484082 | C -> T | LOC_Os04g15600.1 | upstream_gene_variant ; 631.0bp to feature; MODIFIER | silent_mutation | Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0408484082 | C -> T | LOC_Os04g15610.1 | upstream_gene_variant ; 2297.0bp to feature; MODIFIER | silent_mutation | Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| vg0408484082 | C -> T | LOC_Os04g15590-LOC_Os04g15600 | intergenic_region ; MODIFIER | silent_mutation | Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408484082 | NA | 7.61E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | 7.07E-06 | NA | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | 6.36E-07 | NA | mr1118_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | NA | 3.57E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | NA | 1.39E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | NA | 5.20E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408484082 | NA | 1.37E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |