\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408484082:

Variant ID: vg0408484082 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8484082
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTTGGACTATTATCGTAACAACTTTCTCATTTTCTGTTAGTATATTTCGTAAACTGCTACTTCCTCCGTTTCACAATGTAAGTCATTTTAGCATTTT[C/T]
CATATTCATATTGATGTTAATAATGAATCGAAACATATATATCTATCTAGATTCATTAGCATCTATATGAATGTGGGAAATGCTAGAATGACTTACATTG

Reverse complement sequence

CAATGTAAGTCATTCTAGCATTTCCCACATTCATATAGATGCTAATGAATCTAGATAGATATATATGTTTCGATTCATTATTAACATCAATATGAATATG[G/A]
AAAATGCTAAAATGACTTACATTGTGAAACGGAGGAAGTAGCAGTTTACGAAATATACTAACAGAAAATGAGAAAGTTGTTACGATAATAGTCCAACCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 30.70% 1.76% 27.99% NA
All Indica  2759 9.10% 46.90% 2.17% 41.79% NA
All Japonica  1512 88.20% 9.60% 0.93% 1.32% NA
Aus  269 52.80% 0.00% 2.23% 44.98% NA
Indica I  595 0.30% 76.80% 1.18% 21.68% NA
Indica II  465 24.30% 25.60% 2.80% 47.31% NA
Indica III  913 7.40% 40.90% 1.75% 49.95% NA
Indica Intermediate  786 8.80% 43.90% 3.05% 44.27% NA
Temperate Japonica  767 92.80% 5.90% 0.91% 0.39% NA
Tropical Japonica  504 96.40% 1.00% 0.00% 2.58% NA
Japonica Intermediate  241 56.00% 39.40% 2.90% 1.66% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 52.20% 15.60% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408484082 C -> DEL N N silent_mutation Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0408484082 C -> T LOC_Os04g15590.1 upstream_gene_variant ; 1451.0bp to feature; MODIFIER silent_mutation Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0408484082 C -> T LOC_Os04g15600.1 upstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0408484082 C -> T LOC_Os04g15610.1 upstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N
vg0408484082 C -> T LOC_Os04g15590-LOC_Os04g15600 intergenic_region ; MODIFIER silent_mutation Average:40.463; most accessible tissue: Minghui63 flag leaf, score: 68.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408484082 NA 7.61E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 7.07E-06 NA mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 6.36E-07 NA mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 NA 3.57E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 NA 1.39E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 NA 5.20E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408484082 NA 1.37E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251