\
| Variant ID: vg0408482568 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8482568 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 93. )
GAAGGAGAAGGATCAAGATCTTCCCTATCCTTTGGTTTTCCTTGGCTCACTGGAATGTCGTGTGCTCCTCTGTGACTGTGGCAGCAAGTTTGGTCTCACC[A/G]
TAAATCGTGGGGGGGGGGGGGATGGACCAGAGAAGAGGAGAGAAGGAAGAAGAGGCATGACATGTGGGCCAATGTTTTGTTTGATAGGATTGCCATGTGT
ACACATGGCAATCCTATCAAACAAAACATTGGCCCACATGTCATGCCTCTTCTTCCTTCTCTCCTCTTCTCTGGTCCATCCCCCCCCCCCCCACGATTTA[T/C]
GGTGAGACCAAACTTGCTGCCACAGTCACAGAGGAGCACACGACATTCCAGTGAGCCAAGGAAAACCAAAGGATAGGGAAGATCTTGATCCTTCTCCTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 29.80% | 5.95% | 2.35% | NA |
| All Indica | 2759 | 49.80% | 44.40% | 3.81% | 1.92% | NA |
| All Japonica | 1512 | 83.90% | 1.30% | 10.98% | 3.84% | NA |
| Aus | 269 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.40% | 22.70% | 11.60% | 1.34% | NA |
| Indica II | 465 | 46.70% | 50.30% | 2.58% | 0.43% | NA |
| Indica III | 913 | 44.40% | 52.60% | 0.33% | 2.74% | NA |
| Indica Intermediate | 786 | 47.10% | 48.00% | 2.67% | 2.29% | NA |
| Temperate Japonica | 767 | 87.10% | 0.40% | 10.69% | 1.83% | NA |
| Tropical Japonica | 504 | 78.40% | 2.60% | 11.71% | 7.34% | NA |
| Japonica Intermediate | 241 | 85.10% | 1.70% | 10.37% | 2.90% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 32.20% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408482568 | A -> DEL | LOC_Os04g15590.1 | N | frameshift_variant | Average:50.812; most accessible tissue: Callus, score: 79.164 | N | N | N | N |
| vg0408482568 | A -> G | LOC_Os04g15590.1 | missense_variant&splice_region_variant ; p.Trp22Arg; MODERATE | nonsynonymous_codon ; W22R | Average:50.812; most accessible tissue: Callus, score: 79.164 | unknown | unknown | TOLERATED | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408482568 | NA | 3.71E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 4.19E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 4.43E-08 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 1.06E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 4.32E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 3.77E-09 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | 1.78E-07 | 4.69E-20 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | 6.61E-07 | 2.81E-14 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 1.31E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 3.01E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 2.68E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | NA | 7.42E-17 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | 1.49E-06 | 1.77E-15 | mr1830_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | 4.54E-10 | 8.54E-36 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408482568 | 3.09E-13 | 3.12E-33 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |