\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408443712:

Variant ID: vg0408443712 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 8443712
Reference Allele: AGAlternative Allele: GG,A
Primary Allele: GGSecondary Allele: AG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGACCTCGAATCCACAAGTTTCCAAACCGAATTAGGCGATGATTCCAAAAGAGAAAAGGAAGAGGAGATCGAGAAGATCATTTCCCCTCTATCAATTC[AG/GG,A]
CCGGAGAAGGAAAGACGCGGCCGAATTTGGAAGGAGACGGCGGCGGCTTGTGCTAGGGTTTCGGGCGGCGGCGGCGCGAGGTTGAAGACAAGCCTGACAG

Reverse complement sequence

CTGTCAGGCTTGTCTTCAACCTCGCGCCGCCGCCGCCCGAAACCCTAGCACAAGCCGCCGCCGTCTCCTTCCAAATTCGGCCGCGTCTTTCCTTCTCCGG[CT/CC,T]
GAATTGATAGAGGGGAAATGATCTTCTCGATCTCCTCTTCCTTTTCTCTTTTGGAATCATCGCCTAATTCGGTTTGGAAACTTGTGGATTCGAGGTCGAA

Allele Frequencies:

Populations Population SizeFrequency of GG(primary allele) Frequency of AG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 25.90% 0.74% 0.00% NA
All Indica  2759 93.90% 5.40% 0.62% 0.00% NA
All Japonica  1512 35.50% 63.60% 0.86% 0.00% NA
Aus  269 96.70% 2.60% 0.74% 0.00% NA
Indica I  595 94.80% 5.00% 0.17% 0.00% NA
Indica II  465 93.30% 5.60% 1.08% 0.00% NA
Indica III  913 96.30% 3.10% 0.66% 0.00% NA
Indica Intermediate  786 91.00% 8.40% 0.64% 0.00% NA
Temperate Japonica  767 3.90% 95.60% 0.52% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 67.20% 3.73% 0.00% NA
VI/Aromatic  96 21.90% 77.10% 1.04% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408443712 AG -> A LOC_Os04g15520.1 upstream_gene_variant ; 1857.0bp to feature; MODIFIER N Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg0408443712 AG -> A LOC_Os04g15530.1 upstream_gene_variant ; 1491.0bp to feature; MODIFIER N Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg0408443712 AG -> A LOC_Os04g15520-LOC_Os04g15530 intergenic_region ; MODIFIER N Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg0408443712 AG -> GG LOC_Os04g15520.1 upstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg0408443712 AG -> GG LOC_Os04g15530.1 upstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N
vg0408443712 AG -> GG LOC_Os04g15520-LOC_Os04g15530 intergenic_region ; MODIFIER silent_mutation Average:77.541; most accessible tissue: Minghui63 flag leaf, score: 92.894 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0408443712 AG A 0.0 0.0 0.0 0.0 0.01 0.02
vg0408443712 AG GG -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408443712 NA 5.11E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 3.99E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 1.92E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 1.72E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 6.69E-10 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 6.31E-25 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 1.03E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 6.43E-06 2.69E-40 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 3.98E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 6.18E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 1.68E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 8.08E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 4.55E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.07E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.30E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 1.75E-07 6.22E-48 mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 3.17E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.44E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.67E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 6.04E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 1.30E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 5.96E-07 5.68E-39 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.05E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 6.97E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 2.43E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408443712 NA 7.32E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251