\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408433193:

Variant ID: vg0408433193 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8433193
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.17, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTGTCAGCCGATCGGCTGTTTGATCTATTATTTGCAAATCTTGTCAGTTGCAGGATTAAACTAACTGGCACGCCCCCATCTCATTAATCTTTGGACCT[A/G]
CACAGGAGCTAAGCAGATCTCCCAGGCCGGTGTGTTCGATTTTTTCATCATCACAGATTGGCACGCCTGGTGGGACCACGAATTTTATATCCACATGTCT

Reverse complement sequence

AGACATGTGGATATAAAATTCGTGGTCCCACCAGGCGTGCCAATCTGTGATGATGAAAAAATCGAACACACCGGCCTGGGAGATCTGCTTAGCTCCTGTG[T/C]
AGGTCCAAAGATTAATGAGATGGGGGCGTGCCAGTTAGTTTAATCCTGCAACTGACAAGATTTGCAAATAATAGATCAAACAGCCGATCGGCTGACAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 24.70% 1.46% 26.30% NA
All Indica  2759 55.40% 3.20% 2.14% 39.33% NA
All Japonica  1512 34.70% 64.20% 0.07% 1.06% NA
Aus  269 52.80% 1.90% 1.86% 43.49% NA
Indica I  595 76.80% 4.20% 0.67% 18.32% NA
Indica II  465 48.60% 3.70% 2.37% 45.38% NA
Indica III  913 47.50% 0.50% 2.96% 48.96% NA
Indica Intermediate  786 52.30% 5.10% 2.16% 40.46% NA
Temperate Japonica  767 3.30% 96.60% 0.00% 0.13% NA
Tropical Japonica  504 84.50% 13.10% 0.20% 2.18% NA
Japonica Intermediate  241 30.70% 67.60% 0.00% 1.66% NA
VI/Aromatic  96 17.70% 78.10% 1.04% 3.12% NA
Intermediate  90 37.80% 34.40% 3.33% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408433193 A -> DEL N N silent_mutation Average:11.429; most accessible tissue: Callus, score: 52.089 N N N N
vg0408433193 A -> G LOC_Os04g15510.1 upstream_gene_variant ; 95.0bp to feature; MODIFIER silent_mutation Average:11.429; most accessible tissue: Callus, score: 52.089 N N N N
vg0408433193 A -> G LOC_Os04g15000-LOC_Os04g15510 intergenic_region ; MODIFIER silent_mutation Average:11.429; most accessible tissue: Callus, score: 52.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408433193 NA 8.52E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 2.26E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 2.92E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 3.54E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 2.50E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 1.60E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 8.32E-06 1.60E-13 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 5.70E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 2.90E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 2.32E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 8.06E-10 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 8.94E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 8.10E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 5.54E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408433193 NA 7.73E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251