\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408410897:

Variant ID: vg0408410897 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8410897
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATGTAGACCACTTTATGATGGGCGAGATACTCGCTGCCTAAGTTATGGTCGATATGACCAAAGTATAAGACTCCATCGACATGTGATTAATTTCCAAG[T/A]
CAAAGTGTGAAGTGGAACATGCATTAAATCCTCCATTAGTTATGTTGGACATAATTAAGAGAATTTGCTAAATCAAAATACAAAATTTATAGAATTTTGT

Reverse complement sequence

ACAAAATTCTATAAATTTTGTATTTTGATTTAGCAAATTCTCTTAATTATGTCCAACATAACTAATGGAGGATTTAATGCATGTTCCACTTCACACTTTG[A/T]
CTTGGAAATTAATCACATGTCGATGGAGTCTTATACTTTGGTCATATCGACCATAACTTAGGCAGCGAGTATCTCGCCCATCATAAAGTGGTCTACATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 6.10% 8.91% 25.41% NA
All Indica  2759 58.00% 2.30% 6.49% 33.24% NA
All Japonica  1512 64.60% 14.00% 11.97% 9.52% NA
Aus  269 39.00% 0.70% 16.36% 43.87% NA
Indica I  595 24.40% 0.00% 6.22% 69.41% NA
Indica II  465 47.30% 11.80% 13.76% 27.10% NA
Indica III  913 87.80% 0.30% 2.52% 9.31% NA
Indica Intermediate  786 55.00% 0.80% 7.00% 37.28% NA
Temperate Japonica  767 96.70% 0.30% 1.30% 1.69% NA
Tropical Japonica  504 12.10% 38.90% 29.96% 19.05% NA
Japonica Intermediate  241 71.80% 5.40% 8.30% 14.52% NA
VI/Aromatic  96 83.30% 5.20% 8.33% 3.12% NA
Intermediate  90 62.20% 6.70% 10.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408410897 T -> DEL N N silent_mutation Average:10.589; most accessible tissue: Callus, score: 23.387 N N N N
vg0408410897 T -> A LOC_Os04g14960.1 upstream_gene_variant ; 1935.0bp to feature; MODIFIER silent_mutation Average:10.589; most accessible tissue: Callus, score: 23.387 N N N N
vg0408410897 T -> A LOC_Os04g14970.1 intron_variant ; MODIFIER silent_mutation Average:10.589; most accessible tissue: Callus, score: 23.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408410897 5.20E-08 NA mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 9.01E-07 NA mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 1.54E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 2.69E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 7.38E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 2.16E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 5.22E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 9.60E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 3.79E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 1.36E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 2.89E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 1.90E-08 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 8.39E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 7.01E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 1.94E-07 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 2.64E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 3.09E-08 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 4.60E-07 NA mr1490_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 5.45E-12 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 1.18E-07 NA mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408410897 NA 3.22E-09 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251